MirGeneDB

MirGeneDB ID

Sto-Mir-181-P2c

Family name MIR-181 (all species)
Seed ACAUUCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-181-P1a  Sto-Mir-181-P1b  Sto-Mir-181-P1c  Sto-Mir-181-P2a  Sto-Mir-181-P2b 
Orthologues Aca-Mir-181-P2c  Ami-Mir-181-P2c  Bta-Mir-181-P2c  Cfa-Mir-181-P2c  Cpi-Mir-181-P2c  Dno-Mir-181-P2c  Dre-Mir-181-P2c1  Dre-Mir-181-P2c2  Ete-Mir-181-P2c  Hsa-Mir-181-P2c  Mdo-Mir-181-P2c  Mml-Mir-181-P2c  Mmu-Mir-181-P2c  Oan-Mir-181-P2c  Ocu-Mir-181-P2c  Rno-Mir-181-P2c  Sha-Mir-181-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01009266.1: 70250-70309 [+]
Precursor
(pre-Mir +30nt flank)
UCGGCCACCUUUUCUGUAAAGGCCACAAUCAACAUUCAUUGCUGUCGGUGGGUUGUGAAUUAUGGAAAACUCGCUGACCAAUGAGUGGAACUGUGUCCGGAUUGAACACCUUUCACUUGG
Get precursor sequence
Structure
        10        20          30        40        50        60 
UCGGCCACCUUUUCUGUAAA--| C    AUCAA         CU           GUGAAU 
                      GG CACA     CAUUCAUUG  GUCGGUGGGUU      \
                      CC GUGU     GUGAGUAAC  CAGUCGCUCAA      U
GGUUCACUUUCCACAAGUUAGG^ U    CAAG-         --           AAGGUA 
.       110       100        90         80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-181-P2c_5p

MirBase accessionNone
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Star sequence

Sto-Mir-181-P2c_3p*

MirBase accessionNone
Sequence
39- CUCGCUGACCAAUGAGUGGAA -60
Get sequence