MirGeneDB

MirGeneDB ID

Hsa-Mir-181-P2c

Family name MIR-181 (all species)
Seed ACAUUCA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-181d
Paralogues Hsa-Mir-181-P1a  Hsa-Mir-181-P1b  Hsa-Mir-181-P1c  Hsa-Mir-181-P2a  Hsa-Mir-181-P2b 
Orthologues Aca-Mir-181-P2c  Ami-Mir-181-P2c  Bta-Mir-181-P2c  Cfa-Mir-181-P2c  Cpi-Mir-181-P2c  Dno-Mir-181-P2c  Dre-Mir-181-P2c1  Dre-Mir-181-P2c2  Ete-Mir-181-P2c  Mdo-Mir-181-P2c  Mml-Mir-181-P2c  Mmu-Mir-181-P2c  Oan-Mir-181-P2c  Ocu-Mir-181-P2c  Rno-Mir-181-P2c  Sha-Mir-181-P2c  Sto-Mir-181-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 13874910-13874972 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2c)
Mir-181-P1c chr19: 13874725-13874785 [+] UCSC Ensembl
Mir-181-P2c chr19: 13874910-13874972 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCCCCUAGGCCACAGCCGAGGUCACAAUCAACAUUCAUUGUUGUCGGUGGGUUGUGAGGACUGAGGCCAGACCCACCGGGGGAUGAAUGUCACUGUGGCUGGGCCAGACACGGCUUAAGGGG
Get precursor sequence
Structure
        10        20          30        40        50        60  
CUCCCCUAGGCCACAGCCGA--|      AUCA         G UG          GUGAGGA 
                      GGUCACA    ACAUUCAUU U  UCGGUGGGUU       C
                      UCGGUGU    UGUAAGUAG G  GGCCACCCAG       U
GGGGAAUUCGGCACAGACCGGG^      CAC-         G --          ACCGGAG 
 120       110       100         90          80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUGUG in loop
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-181-P2c_5p

MirBase accessionMIMAT0002821
Sequence
0- AACAUUCAUUGUUGUCGGUGGGUU -24
Get sequence
Validated targets microrna.org: MIMAT0002821
TargetScanVert: hsa-miR-181d-5p
miRDB: MIMAT0002821
Star sequence

Hsa-Mir-181-P2c_3p*

MirBase accessionMIMAT0026608
Sequence
43- CCACCGGGGGAUGAAUGUCA -63
Get sequence
Validated targets TargetScanVert: hsa-miR-181d-3p
miRDB: MIMAT0026608