MirGeneDB

MirGeneDB ID

Aca-Mir-181-P2c

Family name MIR-181 (all species)
Seed ACAUUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-181-P1a  Aca-Mir-181-P1b  Aca-Mir-181-P1c  Aca-Mir-181-P2a  Aca-Mir-181-P2b 
Orthologues Ami-Mir-181-P2c  Bta-Mir-181-P2c  Cfa-Mir-181-P2c  Cpi-Mir-181-P2c  Dno-Mir-181-P2c  Dre-Mir-181-P2c1  Dre-Mir-181-P2c2  Ete-Mir-181-P2c  Hsa-Mir-181-P2c  Mdo-Mir-181-P2c  Mml-Mir-181-P2c  Mmu-Mir-181-P2c  Oan-Mir-181-P2c  Ocu-Mir-181-P2c  Rno-Mir-181-P2c  Sha-Mir-181-P2c  Sto-Mir-181-P2c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 77114305-77114366 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAAGUCUACAAAACUAGAAAGUCACAAUCAACAUUCAUUCUGUCGGUGGGUUGUGAUGCUGGAGGAGAACCUCACUGAUCAGUGAAUGCAACUGUGGCUGGAAGAAACUCGUGGUCAGCAC
Get precursor sequence
Structure
        10        20          30        40         50        60 
GAAAGUCUACAAAACUAGAA--|      AUCAA        CU       -    GUGAUGC 
                      AGUCACA     CAUUCAUU  GUCGGUG GGUU       \
                      UCGGUGU     GUAAGUGA  UAGUCAC CCAA       U
CACGACUGGUGCUCAAAGAAGG^      CAAC-        C-       U    GAGGAGG 
120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-181-P2c_5p

MirBase accessionNone
Sequence
0- AACAUUCAUUCUGUCGGUGGGUU -23
Get sequence
Star sequence

Aca-Mir-181-P2c_3p* (predicted)

MirBase accessionNone
Sequence
41- CUCACUGAUCAGUGAAUGCAA -62
Get sequence