MirGeneDB

MirGeneDB ID

Aca-Mir-181-P2b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-181b-1
Paralogues Aca-Mir-181-P1a  Aca-Mir-181-P1b  Aca-Mir-181-P1c  Aca-Mir-181-P2a  Aca-Mir-181-P2c 
Orthologues Ami-Mir-181-P2b  Bta-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dno-Mir-181-P2b  Dre-Mir-181-P2b1  Dre-Mir-181-P2b2  Ete-Mir-181-P2b  Gga-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Oan-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Sto-Mir-181-P2b  Tgu-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343937.1: 20226-20285 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2b)
Mir-181-P2b GL343937.1: 20226-20285 [-] UCSC Ensembl
Mir-181-P1b GL343937.1: 21130-21190 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCACAAAGCACUCAGAUAACGGCUGCAAUCAACAUUCAUUGCUGUCGGUGGGUUUUAGGUUCAGUCAGCUCUCUGACCAAUGAAUGCAAACUGCAGACCAGAUAACGACAAAGACGUAGA
Get precursor sequence
Structure
        10        20          30        40        50        60
CCACAAAGCACUCAGAUAAC-  -|    AUCAA         CU     U     UUAGG 
                     GG CUGCA     CAUUCAUUG  GUCGG GGGUU     U
                     CC GACGU     GUAAGUAAC  CAGUC CUCGA     U
AGAUGCAGAAACAGCAAUAGA  A^    CAAAC         --     U     CUGAC 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-181-P2b_5p

MirBase accessionMIMAT0021810
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Star sequence

Aca-Mir-181-P2b_3p*

MirBase accessionNone
Sequence
38- CUCUCUGACCAAUGAAUGCAAA -60
Get sequence