MirGeneDB

MirGeneDB ID

Bta-Mir-181-P2b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Cow (Bos taurus)
MiRBase ID bta-mir-181b-2
Paralogues Bta-Mir-181-P1a  Bta-Mir-181-P1b  Bta-Mir-181-P1c  Bta-Mir-181-P2a  Bta-Mir-181-P2c 
Orthologues Aca-Mir-181-P2b  Ami-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dno-Mir-181-P2b  Dre-Mir-181-P2b1  Dre-Mir-181-P2b2  Ete-Mir-181-P2b  Gga-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Oan-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Sto-Mir-181-P2b  Tgu-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr11: 95710641-95710700 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2b)
Mir-181-P1b chr11: 95709449-95709508 [+] UCSC Ensembl
Mir-181-P2b chr11: 95710641-95710700 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACCAACUGAAAACACUGAUGGCUGCACUCAACAUUCAUUGCUGUCGGUGGGUUUGACUUUGAAUCAACUCACUGAUCAAUGAAUGUAAACUGCGGACCAAACAACCCAAGGGAAGCAAA
Get precursor sequence
Structure
        10         20         30        40        50        60
CACCAACUGAAAACACUGA-   -|    CUCA          CU           UGACU 
                    UGG CUGCA    ACAUUCAUUG  GUCGGUGGGUU     U
                    ACC GGCGU    UGUAAGUAAC  UAGUCACUCAA     U
AAACGAAGGGAACCCAACAA   A^    CAAA          --           CUAAG 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-181-P2b_5p

MirBase accessionMIMAT0003793
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Validated targets TargetScanVert: bta-miR-181b
Star sequence

Bta-Mir-181-P2b_3p*

MirBase accessionNone
Sequence
38- CUCACUGAUCAAUGAAUGUAAA -60
Get sequence