MirGeneDB

MirGeneDB ID

Sto-Mir-181-P2b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-181-P1a  Sto-Mir-181-P1b  Sto-Mir-181-P1c  Sto-Mir-181-P2a  Sto-Mir-181-P2c 
Orthologues Aca-Mir-181-P2b  Ami-Mir-181-P2b  Bta-Mir-181-P2b  Cfa-Mir-181-P2b  Cli-Mir-181-P2b  Cpi-Mir-181-P2b  Cpo-Mir-181-P2b  Dno-Mir-181-P2b  Dre-Mir-181-P2b1  Dre-Mir-181-P2b2  Ete-Mir-181-P2b  Gga-Mir-181-P2b  Hsa-Mir-181-P2b  Mdo-Mir-181-P2b  Mml-Mir-181-P2b  Mmu-Mir-181-P2b  Oan-Mir-181-P2b  Ocu-Mir-181-P2b  Rno-Mir-181-P2b  Sha-Mir-181-P2b  Tgu-Mir-181-P2b  Xtr-Mir-181-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01004985.1: 164948-165007 [-]
Precursor
(pre-Mir +30nt flank)
AAAUACAAUAUUCAGCAAAAGGUUGCGAUAAACAUUCAUUGCUGUCGGUGGGUUUUACUUUUAAACAACUCACUGAUCAGUGAAUGCAAACUGCAACCCAAACAUCUCUGUUCACUAAAG
Get precursor sequence
Structure
        10        20          30        40        50        60
AAAUACAAUAUUCAGCAAAA--|      AUAAA         CU           UUACU 
                      GGUUGCG     CAUUCAUUG  GUCGGUGGGUU     U
                      CCAACGU     GUAAGUGAC  UAGUCACUCAA     U
GAAAUCACUUGUCUCUACAAAC^      CAAAC         --           CAAAU 
.       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsNo
Tissue expression
 +
To
Mature sequence

Sto-Mir-181-P2b_5p

MirBase accessionNone
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Star sequence

Sto-Mir-181-P2b_3p* (predicted)

MirBase accessionNone
Sequence
38- CUCACUGAUCAGUGAAUGCAAA -60
Get sequence