MirGeneDB

MirGeneDB ID

Aca-Mir-181-P1a

Family name MIR-181 (all species)
Seed ACAUUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-181a-1
Paralogues Aca-Mir-181-P1b  Aca-Mir-181-P1c  Aca-Mir-181-P2a  Aca-Mir-181-P2b  Aca-Mir-181-P2c 
Orthologues Ami-Mir-181-P1a  Bta-Mir-181-P1a  Cfa-Mir-181-P1a  Cli-Mir-181-P1a  Cpi-Mir-181-P1a  Cpo-Mir-181-P1a  Dno-Mir-181-P1a  Dre-Mir-181-P1a1  Dre-Mir-181-P1a2  Ete-Mir-181-P1a  Gga-Mir-181-P1a  Hsa-Mir-181-P1a  Mdo-Mir-181-P1a  Mml-Mir-181-P1a  Mmu-Mir-181-P1a  Oan-Mir-181-P1a  Ocu-Mir-181-P1a  Rno-Mir-181-P1a  Sha-Mir-181-P1a  Sto-Mir-181-P1a  Tgu-Mir-181-P1a  Xtr-Mir-181-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343211.1: 717096-717157 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1a)
Mir-181-P2a GL343211.1: 716903-716963 [-] UCSC Ensembl
Mir-181-P1a GL343211.1: 717096-717157 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGUUCUGUUUCUUGUGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUAAAGUGAAAACCAUCGACCGUUGAUUGUACCCUCCAGCUAACCAUCCUCCUCCUUCCUUCA
Get precursor sequence
Structure
        10         20         30        40        50        60  
GGAGUUCUGUUUCUUGU-    -|  UC  UGA   U      CU       A  UUGGGAUU 
                  GGUU GCU  AG   ACA UCAACG  GUCGGUG GU        \
                  CCAA CGA  UC   UGU AGUUGC  CAGCUAC CA        A
ACUUCCUUCCUCCUCCUA    U^  CC  CCA   U      --       -  AAAGUGAA 
120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-181-P1a_5p

MirBase accessionMIMAT0021809
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Star sequence

Aca-Mir-181-P1a_3p*

MirBase accessionNone
Sequence
40- ACCAUCGACCGUUGAUUGUACC -62
Get sequence