MirGeneDB

MirGeneDB ID

Rno-Mir-181-P1a

Family name MIR-181 (all species)
Seed ACAUUCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-181a-1
Paralogues Rno-Mir-181-P1b  Rno-Mir-181-P1c  Rno-Mir-181-P2a  Rno-Mir-181-P2b  Rno-Mir-181-P2c 
Orthologues Aca-Mir-181-P1a  Ami-Mir-181-P1a  Bta-Mir-181-P1a  Cfa-Mir-181-P1a  Cli-Mir-181-P1a  Cpi-Mir-181-P1a  Cpo-Mir-181-P1a  Dno-Mir-181-P1a  Dre-Mir-181-P1a1  Dre-Mir-181-P1a2  Ete-Mir-181-P1a  Gga-Mir-181-P1a  Hsa-Mir-181-P1a  Mdo-Mir-181-P1a  Mml-Mir-181-P1a  Mmu-Mir-181-P1a  Oan-Mir-181-P1a  Ocu-Mir-181-P1a  Sha-Mir-181-P1a  Sto-Mir-181-P1a  Tgu-Mir-181-P1a  Xtr-Mir-181-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr13: 54952756-54952817 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1a)
Mir-181-P1a chr13: 54952756-54952817 [+] UCSC Ensembl
Mir-181-P2a chr13: 54952938-54952998 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CACACCUCUGGCUCACAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUCAAAUAAAAACCAUCGACCGUUGAUUGUACCCUAUAGCUAACCAUUAUCUACUCCGCGGCU
Get precursor sequence
Structure
        10         20         30        40        50        60  
CACACCUCUGGCUCACA-    -|  UC  UGA   U      CU       A  UUGGAAUU 
                  GGUU GCU  AG   ACA UCAACG  GUCGGUG GU        \
                  CCAA CGA  UC   UGU AGUUGC  CAGCUAC CA        C
UCGGCGCCUCAUCUAUUA    U^  UA  CCA   U      --       -  AAAAUAAA 
120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-181-P1a_5p

MirBase accessionMIMAT0000858
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Validated targets microrna.org: MIMAT0000858
TargetScanVert: rno-miR-181a-5p
miRDB: MIMAT0000858
Star sequence

Rno-Mir-181-P1a_3p*

MirBase accessionMIMAT0000884
Sequence
40- ACCAUCGACCGUUGAUUGUACC -62
Get sequence
Validated targets microrna.org: MIMAT0000884
TargetScanVert: rno-miR-181a-1-3p
miRDB: MIMAT0000884