MirGeneDB

MirGeneDB ID

Rno-Mir-181-P1b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-181a-2
Paralogues Rno-Mir-181-P1a  Rno-Mir-181-P1c  Rno-Mir-181-P2a  Rno-Mir-181-P2b  Rno-Mir-181-P2c 
Orthologues Aca-Mir-181-P1b  Ami-Mir-181-P1b  Bta-Mir-181-P1b  Cfa-Mir-181-P1b  Cli-Mir-181-P1b  Cpi-Mir-181-P1b  Cpo-Mir-181-P1b  Dno-Mir-181-P1b  Dre-Mir-181-P1b  Ete-Mir-181-P1b  Gga-Mir-181-P1b  Hsa-Mir-181-P1b  Mdo-Mir-181-P1b  Mml-Mir-181-P1b  Mmu-Mir-181-P1b  Oan-Mir-181-P1b  Ocu-Mir-181-P1b  Sha-Mir-181-P1b  Sto-Mir-181-P1b  Tgu-Mir-181-P1b  Xtr-Mir-181-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(rn6)
chr3: 23150390-23150456 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1b)
Mir-181-P1b chr3: 23150390-23150456 [+] UCSC Ensembl
Mir-181-P2b chr3: 23151469-23151528 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACCAAGGCAGCCUUAAGAGGACUCCAUGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUCAAAAACAAAAAAAACCACCAACCGUUGACUGUACCUUGGGAUUCUUACAGACAACAAGCUUCCUG
Get precursor sequence
Structure
        10          20        30        40        50        60    
AACCAAGGCAGCCUUAA--|    CU   U  A   U      CU  C    A  UUGGGAUUCA 
                   GAGGA  CCA GG ACA UCAACG  GU GGUG GU          A
                   UUCUU  GGU CC UGU AGUUGC  CA CCAC CA          A
GUCCUUCGAACAACAGACA^    AG   U  A   C      --  A    -  AAAAAAACAA 
     120       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Fa He Ki La Li Li Lu Mu Pa Sk Sm Sp St Te Th
Mature sequence

Rno-Mir-181-P1b_5p

MirBase accessionMIMAT0000858
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Validated targets microrna.org: MIMAT0000858
TargetScanVert: rno-miR-181a-5p
miRDB: MIMAT0000858
Star sequence

Rno-Mir-181-P1b_3p*

MirBase accessionMIMAT0017138
Sequence
45- ACCACCAACCGUUGACUGUACC -67
Get sequence
Validated targets TargetScanVert: rno-miR-181a-2-3p
miRDB: MIMAT0017138