MirGeneDB

MirGeneDB ID

Cli-Mir-181-P1b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-181a-2
Paralogues Cli-Mir-181-P1a  Cli-Mir-181-P2a  Cli-Mir-181-P2b 
Orthologues Aca-Mir-181-P1b  Ami-Mir-181-P1b  Bta-Mir-181-P1b  Cfa-Mir-181-P1b  Cpi-Mir-181-P1b  Cpo-Mir-181-P1b  Dno-Mir-181-P1b  Dre-Mir-181-P1b  Ete-Mir-181-P1b  Gga-Mir-181-P1b  Hsa-Mir-181-P1b  Mdo-Mir-181-P1b  Mml-Mir-181-P1b  Mmu-Mir-181-P1b  Oan-Mir-181-P1b  Ocu-Mir-181-P1b  Rno-Mir-181-P1b  Sha-Mir-181-P1b  Sto-Mir-181-P1b  Tgu-Mir-181-P1b  Xtr-Mir-181-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold686: 919231-919290 [-]
Clustered MiRNAs
(< 10kb from Mir-181-P1b)
Mir-181-P2b scaffold686: 918309-918368 [-]
Mir-181-P1b scaffold686: 919231-919290 [-]
Precursor
(pre-Mir +30nt flank)
GGUAUACGGCAUCUUUGGAUAGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGAGAACUACAAAAACCAUCGACCGUUGACUGUACCUUGAGGUUUAUCACAAACCCUCUCAAUGGA
Get precursor sequence
Structure
        10         20         30        40        50        60 
GGUAUACGGCAUCUUUG-   -|       UGA   U      CU       A  UUGAGAA 
                  GAU AGCUUCAG   ACA UCAACG  GUCGGUG GU       \
                  CUA UUGGAGUU   UGU AGUUGC  CAGCUAC CA       C
AGGUAACUCUCCCAAACA   U^       CCA   C      --       -  AAAACAU 
.       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Mature sequence

Cli-Mir-181-P1b_5p

MirBase accessionMIMAT0038550
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Star sequence

Cli-Mir-181-P1b_3p*

MirBase accessionMIMAT0038552
Sequence
38- ACCAUCGACCGUUGACUGUACC -60
Get sequence