MirGeneDB

MirGeneDB ID

Mmu-Mir-181-P1b

Family name MIR-181 (all species)
Seed ACAUUCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-181a-2
Paralogues Mmu-Mir-181-P1a  Mmu-Mir-181-P1c  Mmu-Mir-181-P2a  Mmu-Mir-181-P2b  Mmu-Mir-181-P2c 
Orthologues Aca-Mir-181-P1b  Ami-Mir-181-P1b  Bta-Mir-181-P1b  Cfa-Mir-181-P1b  Cli-Mir-181-P1b  Cpi-Mir-181-P1b  Cpo-Mir-181-P1b  Dno-Mir-181-P1b  Dre-Mir-181-P1b  Ete-Mir-181-P1b  Gga-Mir-181-P1b  Hsa-Mir-181-P1b  Mdo-Mir-181-P1b  Mml-Mir-181-P1b  Oan-Mir-181-P1b  Ocu-Mir-181-P1b  Rno-Mir-181-P1b  Sha-Mir-181-P1b  Sto-Mir-181-P1b  Tgu-Mir-181-P1b  Xtr-Mir-181-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr2: 38852741-38852806 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1b)
Mir-181-P1b chr2: 38852741-38852806 [+] UCSC Ensembl
Mir-181-P2b chr2: 38853845-38853904 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACCAAGCCAGCCUUAAGAGGACUCCAUGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUCAAAAACAAAAAAACCACCGACCGUUGACUGUACCUUGGGAUUCUUACAGACAACAAGUUUCCUG
Get precursor sequence
Structure
        10          20        30        40        50        60    
AACCAAGCCAGCCUUAA--|    CU   U  A   U      CU       A  UUGGGAUUCA 
                   GAGGA  CCA GG ACA UCAACG  GUCGGUG GU          \
                   UUCUU  GGU CC UGU AGUUGC  CAGCCAC CA          A
GUCCUUUGAACAACAGACA^    AG   U  A   C      --       -  AAAAAACAAA 
    120       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-181-P1b_5p

MirBase accessionMIMAT0000210
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Validated targets microrna.org: MIMAT0000210
TargetScanVert: mmu-miR-181a-5p
miRDB: MIMAT0000210
Star sequence

Mmu-Mir-181-P1b_3p*

MirBase accessionMIMAT0005443
Sequence
44- ACCACCGACCGUUGACUGUACC -66
Get sequence
Validated targets microrna.org: MIMAT0005443
TargetScanVert: mmu-miR-181a-2-3p
miRDB: MIMAT0005443