MirGeneDB

MirGeneDB ID

Aca-Mir-181-P1b

Family name MIR-181 (all species)
Seed ACAUUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-181a-2
Paralogues Aca-Mir-181-P1a  Aca-Mir-181-P1c  Aca-Mir-181-P2a  Aca-Mir-181-P2b  Aca-Mir-181-P2c 
Orthologues Ami-Mir-181-P1b  Bta-Mir-181-P1b  Cfa-Mir-181-P1b  Cli-Mir-181-P1b  Cpi-Mir-181-P1b  Cpo-Mir-181-P1b  Dno-Mir-181-P1b  Dre-Mir-181-P1b  Ete-Mir-181-P1b  Gga-Mir-181-P1b  Hsa-Mir-181-P1b  Mdo-Mir-181-P1b  Mml-Mir-181-P1b  Mmu-Mir-181-P1b  Oan-Mir-181-P1b  Ocu-Mir-181-P1b  Rno-Mir-181-P1b  Sha-Mir-181-P1b  Sto-Mir-181-P1b  Tgu-Mir-181-P1b  Xtr-Mir-181-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343937.1: 21130-21190 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1b)
Mir-181-P2b GL343937.1: 20226-20285 [-] UCSC Ensembl
Mir-181-P1b GL343937.1: 21130-21190 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGGCAAAUGGCCACAGGAUAGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUCGAGAGCAAACCAUCGACCGUUGACUGUACCUUGAGGUUUAUCACUGACACGUGGGACAAC
Get precursor sequence
Structure
        10         20         30        40        50        60 
CAGGCAAAUGGCCACAG-   -|       UGA   U      CU       A  UUGGAAU 
                  GAU AGCUUCAG   ACA UCAACG  GUCGGUG GU       C
                  CUA UUGGAGUU   UGU AGUUGC  CAGCUAC CA       G
CAACAGGGUGCACAGUCA   U^       CCA   C      --       -  AACGAGA 
 .       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-181-P1b_5p

MirBase accessionMIMAT0021809
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Star sequence

Aca-Mir-181-P1b_3p*

MirBase accessionNone
Sequence
39- ACCAUCGACCGUUGACUGUACC -61
Get sequence