MirGeneDB

MirGeneDB ID

Aca-Mir-181-P2a

Family name MIR-181 (all species)
Seed ACAUUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-181b-2
Paralogues Aca-Mir-181-P1a  Aca-Mir-181-P1b  Aca-Mir-181-P1c  Aca-Mir-181-P2b  Aca-Mir-181-P2c 
Orthologues Ami-Mir-181-P2a  Bta-Mir-181-P2a  Cfa-Mir-181-P2a  Cli-Mir-181-P2a  Cpi-Mir-181-P2a  Cpo-Mir-181-P2a  Dno-Mir-181-P2a  Dre-Mir-181-P2a1  Ete-Mir-181-P2a  Gga-Mir-181-P2a  Hsa-Mir-181-P2a  Mdo-Mir-181-P2a  Mml-Mir-181-P2a  Mmu-Mir-181-P2a  Oan-Mir-181-P2a  Ocu-Mir-181-P2a  Rno-Mir-181-P2a  Sha-Mir-181-P2a  Sto-Mir-181-P2a  Tgu-Mir-181-P2a  Xtr-Mir-181-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343211.1: 716903-716963 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P2a)
Mir-181-P2a GL343211.1: 716903-716963 [-] UCSC Ensembl
Mir-181-P1a GL343211.1: 717096-717157 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUCUCUCUCAUACACAAAAGGUCACAAUCAACAUUCAUUGCUGUCGGUGGGUUUAACUAUGUGGACAAGCUCACUGAACAAUGAAUGCAACUGUGGCCCCACUUUUUACAGUCACAGCCA
Get precursor sequence
Structure
        10        20          30        40        50        60 
AAUCUCUCUCAUACACAAAA--|      AUCAA         CUG          UAACUA 
                      GGUCACA     CAUUCAUUG   UCGGUGGGUU      U
                      CCGGUGU     GUAAGUAAC   AGUCACUCGA      G
ACCGACACUGACAUUUUUCACC^      CAAC-         A--          ACAGGU 
 .       110       100        90         80          70
Deep sequencing
Go to detailed chart
CommentThere is a 3p read -1 expressed at higher levels but there is no corresponding 5p read. This read is also seen in most other data sets but at much lower levels than the annotated read.
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-181-P2a_5p

MirBase accessionMIMAT0021810
Sequence
0- AACAUUCAUUGCUGUCGGUGGGUU -24
Get sequence
Star sequence

Aca-Mir-181-P2a_3p*

MirBase accessionNone
Sequence
40- CUCACUGAACAAUGAAUGCAA -61
Get sequence