MirGeneDB

MirGeneDB ID

Aca-Mir-181-P1c

Family name MIR-181 (all species)
Seed ACAUUCA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-181a-3
Paralogues Aca-Mir-181-P1a  Aca-Mir-181-P1b  Aca-Mir-181-P2a  Aca-Mir-181-P2b  Aca-Mir-181-P2c 
Orthologues Ami-Mir-181-P1c  Bta-Mir-181-P1c  Cfa-Mir-181-P1c  Cpi-Mir-181-P1c  Cpo-Mir-181-P1c  Dno-Mir-181-P1c  Dre-Mir-181-P1c1  Dre-Mir-181-P1c2  Ete-Mir-181-P1c  Hsa-Mir-181-P1c  Mdo-Mir-181-P1c  Mml-Mir-181-P1c  Mmu-Mir-181-P1c  Oan-Mir-181-P1c  Ocu-Mir-181-P1c  Rno-Mir-181-P1c  Sha-Mir-181-P1c  Sto-Mir-181-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 77116241-77116302 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUAUCUGGAGAAGAUAAAAGGUCUUGGGAAACAUUCAACGCUGUCGGUGAGUUUUGUCAAUGAAGUCAAACCAUCGACUGUUGAGUGUACCCUGCGGCUUUUACAAACACUGCCCAUGAAG
Get precursor sequence
Structure
        10          20        30        40        50        60  
CAUAUCUGGAGAAGAUA--|      U    AA          CU       A  UUUGUCAA 
                   AAAGGUC UGGG  ACAUUCAACG  GUCGGUG GU        \
                   UUUUCGG GUCC  UGUGAGUUGU  CAGCUAC CA        U
GAAGUACCCGUCACAAACA^      C    CA          --       -  AACUGAAG 
120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-181-P1c_5p

MirBase accessionMIMAT0021809
Sequence
0- AACAUUCAACGCUGUCGGUGAGU -23
Get sequence
Star sequence

Aca-Mir-181-P1c_3p*

MirBase accessionNone
Sequence
40- ACCAUCGACUGUUGAGUGUACC -62
Get sequence