MirGeneDB

MirGeneDB ID

Mmu-Mir-181-P1c

Family name MIR-181 (all species)
Seed ACAUUCA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-181c
Paralogues Mmu-Mir-181-P1a  Mmu-Mir-181-P1b  Mmu-Mir-181-P2a  Mmu-Mir-181-P2b  Mmu-Mir-181-P2c 
Orthologues Aca-Mir-181-P1c  Ami-Mir-181-P1c  Bta-Mir-181-P1c  Cfa-Mir-181-P1c  Cpi-Mir-181-P1c  Cpo-Mir-181-P1c  Dno-Mir-181-P1c  Dre-Mir-181-P1c1  Dre-Mir-181-P1c2  Ete-Mir-181-P1c  Hsa-Mir-181-P1c  Mdo-Mir-181-P1c  Mml-Mir-181-P1c  Oan-Mir-181-P1c  Ocu-Mir-181-P1c  Rno-Mir-181-P1c  Sha-Mir-181-P1c  Sto-Mir-181-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr8: 84178885-84178945 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-181-P1c)
Mir-181-P2c chr8: 84178720-84178781 [-] UCSC Ensembl
Mir-181-P1c chr8: 84178885-84178945 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUAUCCAAGAACUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCAGACAAACCAUCGACCGUUGAGUGGACCCCGAGGCCUGGAACUGCCACCCGUCUACCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
UUAUCCAAGAACUUGCCAA--|     G    AA        CU       A   UGGGCAG 
                     GGGUUU GGGG  CAUUCAAC  GUCGGUG GUU       \
                     UCCGGA CCCC  GUGAGUUG  CAGCUAC CAA       C
CCCAUCUGCCCACCGUCAAGG^     G    AG        C-       -   ACAGACU 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-181-P1c_5p

MirBase accessionMIMAT0000674
Sequence
0- AACAUUCAACCUGUCGGUGAGUU -23
Get sequence
Validated targets microrna.org: MIMAT0000674
TargetScanVert: mmu-miR-181c-5p
miRDB: MIMAT0000674
Star sequence

Mmu-Mir-181-P1c_3p*

MirBase accessionMIMAT0017068
Sequence
39- ACCAUCGACCGUUGAGUGGACC -61
Get sequence
Validated targets TargetScanVert: mmu-miR-181c-3p
miRDB: MIMAT0017068