MirGeneDB

MirGeneDB ID

Hme-Bantam

Family name BANTAM (all species)
Seed GAGAUCA
Species Longwing butterfly (Heliconius melpomene)
MiRBase ID hme-bantam
Paralogues
Orthologues Aae-Bantam  Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4  Bge-Bantam  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cbr-Bantam-P2  Cbr-Bantam-P3  Cbr-Bantam-P4  Cel-Bantam-P1  Cel-Bantam-P2  Cel-Bantam-P3  Cel-Bantam-P4  Cel-Bantam-P5a  Cel-Bantam-P5b  Cel-Bantam-P5c  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Efe-Bantam-P6  Efe-Bantam-P7  Efe-Bantam-P8  Isc-Bantam-P9a  Isc-Bantam-P9b  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Hmel_1)
HE670669: 51613-51673 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGAAGAAAUACAAGAAAAGGAAUUACGAGACUGGUUUUCAUAAUGAUUUGACAGAUUGAUACAUAUUCUGAGAUCAUUGUGAAAGCUAAUUUUGUUCCUUGGUCGUCUUGGAAAACAAUUG
Get precursor sequence
Structure
        10             20        30        40        50          
UGAAGAAAUACAAGAAA-----|   AUU      C                  GACAGAUUGA 
                      AGGA   ACGAGA UGGUUUUCAUAAUGAUUU          \
                      UCCU   UGUUUU AUCGAAAGUGUUACUAGA          U
GUUAACAAAAGGUUCUGCUGGU^   ---      A                  GUCUUAUACA 
 .       110       100           90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Fe Fe Fe Fe Ma Ma
Star sequence

Hme-Bantam_5p*

MirBase accessionNone
Sequence
0- CUGGUUUUCAUAAUGAUUUGACA -23
Get sequence
Mature sequence

Hme-Bantam_3p

MirBase accessionMIMAT0024930
Sequence
38- UGAGAUCAUUGUGAAAGCUAAUU -61
Get sequence