MirGeneDB

MirGeneDB ID

Bge-Bantam

Family name BANTAM (all species)
Seed GAGAUCA
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues
Orthologues Aae-Bantam  Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cbr-Bantam-P2  Cbr-Bantam-P3  Cbr-Bantam-P4  Cel-Bantam-P1  Cel-Bantam-P2  Cel-Bantam-P3  Cel-Bantam-P4  Cel-Bantam-P5a  Cel-Bantam-P5b  Cel-Bantam-P5c  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Efe-Bantam-P6  Efe-Bantam-P7  Efe-Bantam-P8  Hme-Bantam  Isc-Bantam-P9a  Isc-Bantam-P9b  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ614636.1: 591905-591964 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUACAGCAUCUGCCAAGCCAUGAGACGAAGCCGGUUUUCACAGUGAUUUGCCAGAUAUGUUAAAUUCUGAGAUCAUUGUGAAAGCUGAUUUUGUUGAGUAGCUCUUCAGGAAAGCAGCAC
Get precursor sequence
Structure
        10          20        30        40        50        60
GUACAGCAUCUGCCAAGCC--| GA      GC                  GC    UAUG 
                     AU  GACGAA  CGGUUUUCACAGUGAUUU  CAGA    U
                     UG  UUGUUU  GUCGAAAGUGUUACUAGA  GUCU    U
CACGACGAAAGGACUUCUCGA^ AG      UA                  --    UAAA 
.       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Bantam_5p*

MirBase accessionNone
Sequence
0- CCGGUUUUCACAGUGAUUUGCCAGA -25
Get sequence
Mature sequence

Bge-Bantam_3p

MirBase accessionNone
Sequence
37- UGAGAUCAUUGUGAAAGCUGAUU -60
Get sequence