MirGeneDB

MirGeneDB ID

Isc-Bantam-P9b

Family name BANTAM (all species)
Seed GAGAUCA
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-bantam
Paralogues Isc-Bantam-P9a 
Orthologues Aae-Bantam  Bge-Bantam  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Hme-Bantam  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) Ixodes
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS612599: 38790-38850 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CGGCAUCUGCCGAAGAAACGCCAGACAAAACUGGUUUUCACAAUGAUCGUCCAGAUGGACCUGAAGUCUGAGAUCAUUGUGAAAGCUGAUUUUGUUGAUUCAGAGCUUCACGUCCACCACC
Get precursor sequence
Structure
        10        20          30        40        50        60 
CGGCAUCUGCCGAAGAAACGCCA--|      CU                GUC    UGGAC 
                         GACAAAA  GGUUUUCACAAUGAUC   CAGA     \
                         UUGUUUU  UCGAAAGUGUUACUAG   GUCU     C
CCACCACCUGCACUUCGAGACUUAG^      AG                A--    GAAGU 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Bantam-P9b_5p*

MirBase accessionNone
Sequence
0- CUGGUUUUCACAAUGAUCGUCCAGA -25
Get sequence
Mature sequence

Isc-Bantam-P9b_3p

MirBase accessionMIMAT0012679
Sequence
38- UGAGAUCAUUGUGAAAGCUGAUU -61
Get sequence