MirGeneDB

MirGeneDB ID

Dpu-Bantam

Family name BANTAM (all species)
Seed GAGAUCA
Species Common water flea (Daphnia pulex)
MiRBase ID dpu-bantam
Paralogues
Orthologues Aae-Bantam  Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4  Bge-Bantam  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cbr-Bantam-P2  Cbr-Bantam-P3  Cbr-Bantam-P4  Cel-Bantam-P1  Cel-Bantam-P2  Cel-Bantam-P3  Cel-Bantam-P4  Cel-Bantam-P5a  Cel-Bantam-P5b  Cel-Bantam-P5c  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Efe-Bantam-P6  Efe-Bantam-P7  Efe-Bantam-P8  Hme-Bantam  Isc-Bantam-P9a  Isc-Bantam-P9b  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Daphnia_pulex.V1.0)
DAPPUscaffold_115: 370169-370231 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUGUGAAUUUUCGGCUUUUAAACCUCGAGACUAGUUUUCUCAGUGAUCUGCCAGAUAUUAUUUGAAUUUCUGAGAUCAUUGUGAAAGCUGAUUUUGUGGAUAGCCUCGACUAGAUGCAUAGAC
Get precursor sequence
Structure
        10        20          30        40        50        60  
GUGUGAAUUUUCGGCUUUUAAA--| U     C        U         GC    UAUUAU 
                        CC CGAGA UAGUUUUC CAGUGAUCU  CAGA      \
                        GG GUUUU GUCGAAAG GUUACUAGA  GUCU      U
CAGAUACGUAGAUCAGCUCCGAUA^ U     A        U         --    UUAAGU 
 120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Dpu-Bantam_5p*

MirBase accessionNone
Sequence
0- CUAGUUUUCUCAGUGAUCUGCCAGA -25
Get sequence
Mature sequence

Dpu-Bantam_3p

MirBase accessionMIMAT0012634
Sequence
40- UGAGAUCAUUGUGAAAGCUGAUU -63
Get sequence