MirGeneDB

MirGeneDB ID

Cte-Bantam

Family name BANTAM (all species)
Seed GAGAUCA
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-bantam
Paralogues
Orthologues Aae-Bantam  Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4  Bge-Bantam  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cbr-Bantam-P2  Cbr-Bantam-P3  Cbr-Bantam-P4  Cel-Bantam-P1  Cel-Bantam-P2  Cel-Bantam-P3  Cel-Bantam-P4  Cel-Bantam-P5a  Cel-Bantam-P5b  Cel-Bantam-P5c  Cgi-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Efe-Bantam-P6  Efe-Bantam-P7  Efe-Bantam-P8  Hme-Bantam  Isc-Bantam-P9a  Isc-Bantam-P9b  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_114: 319164-319225 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GCGAAUGUUUCAGAGCAAGACUUGCGAGACUGGUUUUCUCUUUGGUCUUCCAGAUUUUUAUUGGAAUUCUGAGAUCAUUGUGAAAACUAAUCUCGCUGACAUUACGCCAGAUCUUUAAUUCA
Get precursor sequence
Structure
        10        20           30        40        50        60 
GCGAAUGUUUCAGAGCAAGACUU---|     C        UCUU      UC    UUUUUA 
                          GCGAGA UGGUUUUC    UGGUCU  CAGA      \
                          CGCUCU AUCAAAAG    ACUAGA  GUCU      U
ACUUAAUUUCUAGACCGCAUUACAGU^     A        UGUU      --    UAAGGU 
120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Cte-Bantam_5p* (predicted)

MirBase accessionNone
Sequence
0- UGGUUUUCUCUUUGGUCUUCCAGA -24
Get sequence
Mature sequence

Cte-Bantam_3p

MirBase accessionMIMAT0009551
Sequence
39- UGAGAUCAUUGUGAAAACUAAUC -62
Get sequence