MirGeneDB

MirGeneDB ID

Dme-Bantam

Family name BANTAM (all species)
Seed GAGAUCA
Species Fruit fly (Drosophila melanogaster)
MiRBase ID dme-bantam
Paralogues
Orthologues Aae-Bantam  Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4  Bge-Bantam  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cbr-Bantam-P2  Cbr-Bantam-P3  Cbr-Bantam-P4  Cel-Bantam-P1  Cel-Bantam-P2  Cel-Bantam-P3  Cel-Bantam-P4  Cel-Bantam-P5a  Cel-Bantam-P5b  Cel-Bantam-P5c  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dmo-Bantam  Dpu-Bantam  Efe-Bantam-P6  Efe-Bantam-P7  Efe-Bantam-P8  Hme-Bantam  Isc-Bantam-P9a  Isc-Bantam-P9b  Lan-Bantam  Lgi-Bantam  Tca-Bantam 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(dm6)
chr3L: 642222-642281 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUUUGUAACUCCAAUGAUUUGACUACGAAACCGGUUUUCGAUUUGGUUUGACUGUUUUUCAUACAAGUGAGAUCAUUUUGAAAGCUGAUUUUGUCAAUGAAUACCACAUUCCACAUUCCG
Get precursor sequence
Structure
        10             20        30        40        50         
GUUUGUAACUCCAAUGAU-----|    UAC    C          UU      G   GUUUU 
                       UUGAC   GAAA CGGUUUUCGA  UGGUUU ACU     U
                       AACUG   UUUU GUCGAAAGUU  ACUAGA UGA     C
GCCUUACACCUUACACCAUAAGU^    ---    A          UU      G   ACAUA 
.       110       100           90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo He L3 Fe Fe La Wh
Star sequence

Dme-Bantam_5p*

MirBase accessionMIMAT0020823
Sequence
0- CCGGUUUUCGAUUUGGUUUGACU -23
Get sequence
Mature sequence

Dme-Bantam_3p

MirBase accessionMIMAT0000365
Sequence
37- UGAGAUCAUUUUGAAAGCUGAUU -60
Get sequence
Validated targets microrna.org: MIMAT0000365
TargetScanFly: dme-bantam