MirGeneDB

MirGeneDB ID

Lgi-Bantam

Family name BANTAM (all species)
Seed GAGAUCA
Species Owl limpet (Lottia gigantea)
MiRBase ID
Paralogues
Orthologues Aae-Bantam  Asu-Bantam-o1  Asu-Bantam-o2  Asu-Bantam-o3  Asu-Bantam-o4  Bge-Bantam  Cbr-Bantam-P1a  Cbr-Bantam-P1b  Cbr-Bantam-P2  Cbr-Bantam-P3  Cbr-Bantam-P4  Cel-Bantam-P1  Cel-Bantam-P2  Cel-Bantam-P3  Cel-Bantam-P4  Cel-Bantam-P5a  Cel-Bantam-P5b  Cel-Bantam-P5c  Cgi-Bantam  Cte-Bantam  Dan-Bantam  Dme-Bantam  Dmo-Bantam  Dpu-Bantam  Efe-Bantam-P6  Efe-Bantam-P7  Efe-Bantam-P8  Hme-Bantam  Isc-Bantam-P9a  Isc-Bantam-P9b  Lan-Bantam  Tca-Bantam 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_212: 233725-233783 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGACUUGCAGUUGACUUACUAGAUGAAACUGGUUUUCAUAGUGGUUUCGUAAAUAUUUUAAUUGUGAGAUCACUGUGAAAACUAAUUUUGUCGAUUCGAAUCUUCAGGAGAUAUAUU
Get precursor sequence
Structure
        10        20          30        40        50         
GAAGACUUGCAGUUGACUUACUA--| UG   C                    UAAAUAU 
                         GA  AAA UGGUUUUCAUAGUGGUUUCG       \
                         CU  UUU AUCAAAAGUGUCACUAGAGU       U
UUAUAUAGAGGACUUCUAAGCUUAG^ GU   A                    GUUAAUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Lgi-Bantam_5p*

MirBase accessionNone
Sequence
0- CUGGUUUUCAUAGUGGUUUCGUA -23
Get sequence
Mature sequence

Lgi-Bantam_3p

MirBase accessionNone
Sequence
36- UGAGAUCACUGUGAAAACUAAUU -59
Get sequence