MirGeneDB

MirGeneDB ID

Cte-Mir-193-P2

Family name MIR-193 (all species)
Seed AAUGCCC
Species Polychaete worm (Capitella teleta)
MiRBase ID cte-mir-365
Paralogues Cte-Mir-193-P1 
Orthologues Aca-Mir-193-P2a  Ami-Mir-193-P2a  Ami-Mir-193-P2b  Bge-Mir-193-P2  Bta-Mir-193-P2a  Bta-Mir-193-P2b  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2a  Cfa-Mir-193-P2b  Cgi-Mir-193-P2  Cli-Mir-193-P2a  Cli-Mir-193-P2b  Cpi-Mir-193-P2a  Cpi-Mir-193-P2b  Cpo-Mir-193-P2a  Cpo-Mir-193-P2b  Dno-Mir-193-P2a  Dno-Mir-193-P2b  Dre-Mir-193-P2a1  Dre-Mir-193-P2a2  Dre-Mir-193-P2b1  Efe-Mir-193-P2c-v1  Efe-Mir-193-P2c-v2  Efe-Mir-193-P2d-v1  Efe-Mir-193-P2d-v2  Efe-Mir-193-P2e-v1  Efe-Mir-193-P2e-v2  Efe-Mir-193-P2f-v1  Efe-Mir-193-P2f-v2  Ete-Mir-193-P2a  Ete-Mir-193-P2b  Gga-Mir-193-P2a  Gga-Mir-193-P2b  Hme-Mir-193-P2  Hsa-Mir-193-P2a  Hsa-Mir-193-P2b  Lan-Mir-193-P2i  Lan-Mir-193-P2j  Lgi-Mir-193-P2  Mdo-Mir-193-P2b  Mml-Mir-193-P2a  Mml-Mir-193-P2b  Mmu-Mir-193-P2a  Mmu-Mir-193-P2b  Oan-Mir-193-P2a  Oan-Mir-193-P2b  Ocu-Mir-193-P2a  Ocu-Mir-193-P2b  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2a  Rno-Mir-193-P2b  Sha-Mir-193-P2a  Sha-Mir-193-P2b  Sko-Mir-193-P2  Sto-Mir-193-P2b  Tca-Mir-193-P2  Tgu-Mir-193-P2a  Tgu-Mir-193-P2b  Xtr-Mir-193-P2b 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Capitella_teleta_v1.0)
CAPTEscaffold_481: 63203-63261 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUCUUCUUCUUCACCCAUCAGAUAUAUUCGGGGUUUAAAAGGGUAUUUUUUGACAUUCGACUGGAGAAUGCCCUUUCAAAUCCUGGGUCUCUCUGAGCCUGACAUCUCGCUUGUACU
Get precursor sequence
Structure
        10          20        30        40        50         
UCUUCUUCUUCUUCACCCA--|    UAU           A             UGACAU 
                     UCAGA   AUUCGGGGUUU AAAGGGUAUUUUU      \
                     AGUCU   UGGGUCCUAAA UUUCCCGUAAGAG      U
UCAUGUUCGCUCUACAGUCCG^    CUC           C             GUCAGC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cte-Mir-193-P2_5p* (predicted)

MirBase accessionNone
Sequence
0- CGGGGUUUAAAAGGGUAUUUUU -22
Get sequence
Mature sequence

Cte-Mir-193-P2_3p

MirBase accessionMIMAT0009543
Sequence
37- GAAUGCCCUUUCAAAUCCUGGG -59
Get sequence