MirGeneDB

MirGeneDB ID

Mmu-Mir-193-P2b

Family name MIR-193 (all species)
Seed AAUGCCC
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-365-1
Paralogues Mmu-Mir-193-P1a  Mmu-Mir-193-P1b  Mmu-Mir-193-P2a 
Orthologues Ami-Mir-193-P2b  Bge-Mir-193-P2  Bta-Mir-193-P2b  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2b  Cgi-Mir-193-P2  Cli-Mir-193-P2b  Cpi-Mir-193-P2b  Cpo-Mir-193-P2b  Cte-Mir-193-P2  Dno-Mir-193-P2b  Dre-Mir-193-P2b1  Ete-Mir-193-P2b  Gga-Mir-193-P2b  Hme-Mir-193-P2  Hsa-Mir-193-P2b  Lgi-Mir-193-P2  Mdo-Mir-193-P2b  Mml-Mir-193-P2b  Oan-Mir-193-P2b  Ocu-Mir-193-P2b  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2b  Sha-Mir-193-P2b  Sko-Mir-193-P2  Sto-Mir-193-P2b  Tca-Mir-193-P2  Tgu-Mir-193-P2b  Xtr-Mir-193-P2b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr16: 13453855-13453915 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P2b)
Mir-193-P1b chr16: 13449533-13449591 [+] UCSC Ensembl
Mir-193-P2b chr16: 13453855-13453915 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAGCUGAUUGGUUACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUCCGCUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUAUUCCUCGGGGGUCCCC
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCCAGCUGAUUGGUUACC--|     AA        AC           GA    UUUCCAU 
                    GCAGGG  AAUGAGGG  UUUUGGGGGCA  UGUG       \
                    CGUUCU  UUAUUCCU  AAAAUCCCCGU  AUAC       U
CCCCUGGGGGCUCCUUAUGA^     CG        A-           A-    UAUCGCC 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-193-P2b_5p*

MirBase accessionMIMAT0017077
Sequence
0- AGGGACUUUUGGGGGCAGAUGUG -23
Get sequence
Validated targets TargetScanVert: mmu-miR-365-1-5p
miRDB: MIMAT0017077
Mature sequence

Mmu-Mir-193-P2b_3p

MirBase accessionMIMAT0000711
Sequence
40- UAAUGCCCCUAAAAAUCCUUA -61
Get sequence
Validated targets microrna.org: MIMAT0000711
TargetScanVert: mmu-miR-365-3p
miRDB: MIMAT0000711