MirGeneDB

MirGeneDB ID

Sto-Mir-193-P2b

Family name MIR-193 (all species)
Seed AAUGCCC
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-193-P1b 
Orthologues Ami-Mir-193-P2b  Bge-Mir-193-P2  Bta-Mir-193-P2b  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2b  Cgi-Mir-193-P2  Cli-Mir-193-P2b  Cpi-Mir-193-P2b  Cpo-Mir-193-P2b  Cte-Mir-193-P2  Dno-Mir-193-P2b  Dre-Mir-193-P2b1  Ete-Mir-193-P2b  Gga-Mir-193-P2b  Hme-Mir-193-P2  Hsa-Mir-193-P2b  Lgi-Mir-193-P2  Mdo-Mir-193-P2b  Mml-Mir-193-P2b  Mmu-Mir-193-P2b  Oan-Mir-193-P2b  Ocu-Mir-193-P2b  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2b  Sha-Mir-193-P2b  Sko-Mir-193-P2  Tca-Mir-193-P2  Tgu-Mir-193-P2b  Xtr-Mir-193-P2b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(miRNA_loci_genome)
BFAA01002690.1: 352079-352138 [-]
Precursor
(pre-Mir +30nt flank)
AAAAAUGAGCGCAGUUCCGCAGGGAAAGUGAGGGACUUUUGGGGGCAGGUAUGUUUCAGCUGCACAAUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCCUGCAGUAAUCGUCAAGAUACAA
Get precursor sequence
Structure
        10         20        30        40        50        60 
AAAAAUGAGCGCAGUUCC-|      A        AC           GG    UUUCAGC 
                   GCAGGGA AGUGAGGG  UUUUGGGGGCA  UAUG       \
                   CGUCCUU UUAUUCCU  AAAAUCCCCGU  AUAC       U
AACAUAGAACUGCUAAUGA^      G        A-           A-    UAACACG 
.       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-193-P2b_5p*

MirBase accessionNone
Sequence
0- AGGGACUUUUGGGGGCAGGUAUGU -24
Get sequence
Mature sequence

Sto-Mir-193-P2b_3p

MirBase accessionNone
Sequence
40- UAAUGCCCCUAAAAAUCCUU -60
Get sequence