MirGeneDB

MirGeneDB ID

Cli-Mir-193-P2b

Family name MIR-193 (all species)
Seed AAUGCCC
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-365-1
Paralogues Cli-Mir-193-P1b  Cli-Mir-193-P2a 
Orthologues Ami-Mir-193-P2b  Bge-Mir-193-P2  Bta-Mir-193-P2b  Cbr-Mir-193-P2-v1  Cbr-Mir-193-P2-v2  Cel-Mir-193-P2-v1  Cel-Mir-193-P2-v2  Cfa-Mir-193-P2b  Cgi-Mir-193-P2  Cpi-Mir-193-P2b  Cpo-Mir-193-P2b  Cte-Mir-193-P2  Dno-Mir-193-P2b  Dre-Mir-193-P2b1  Ete-Mir-193-P2b  Gga-Mir-193-P2b  Hme-Mir-193-P2  Hsa-Mir-193-P2b  Lgi-Mir-193-P2  Mdo-Mir-193-P2b  Mml-Mir-193-P2b  Mmu-Mir-193-P2b  Oan-Mir-193-P2b  Ocu-Mir-193-P2b  Pfl-Mir-193-P2  Pmi-Mir-193-P2  Rno-Mir-193-P2b  Sha-Mir-193-P2b  Sko-Mir-193-P2  Sto-Mir-193-P2b  Tca-Mir-193-P2  Tgu-Mir-193-P2b  Xtr-Mir-193-P2b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(colLiv2)
scaffold251: 992954-993014 [+]
Clustered MiRNAs
(< 10kb from Mir-193-P2b)
Mir-193-P1b scaffold251: 987730-987788 [+]
Mir-193-P2b scaffold251: 992954-993014 [+]
Precursor
(pre-Mir +30nt flank)
CCUGCAUGGCUCUGUACCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGAUGUGUUUCCAUUACACUAUCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCAGUAUUCUUCUGUGUUGCUG
Get precursor sequence
Structure
        10          20        30        40        50        60 
CCUGCAUGGCUCUGUACC--|     AA        AC           GA    UUUCCAU 
                    GCAGGG  AAUGAGGG  UUUUGGGGGCA  UGUG       \
                    CGUUCU  UUAUUCCU  AAAAUCCCCGU  AUAC       U
GUCGUUGUGUCUUCUUAUGA^     CG        A-           A-    UAUCACA 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Cli-Mir-193-P2b_5p*

MirBase accessionMIMAT0038624
Sequence
0- AGGGACUUUUGGGGGCAGAUGUG -23
Get sequence
Mature sequence

Cli-Mir-193-P2b_3p

MirBase accessionMIMAT0038625
Sequence
40- UAAUGCCCCUAAAAAUCCUUA -61
Get sequence