MirGeneDB 3.0
MirGeneDB ID

Rno-Mir-193-P2b

Family name MIR-193 (all species)
Species Norway rat (Rattus norvegicus)
MiRBase ID rno-mir-365
Paralogues Rno-Mir-193-P1a  Rno-Mir-193-P1b  Rno-Mir-193-P2a 
Orthologues Aca-Mir-193-P2b  Ami-Mir-193-P2b  Bge-Mir-193-P2  Bta-Mir-193-P2b  Cbr-Mir-193-P2-v1  Cel-Mir-193-P2-v1  Cfa-Mir-193-P2b  Cja-Mir-193-P2b  Cli-Mir-193-P2b  Cmi-Mir-193-P2b  Cpi-Mir-193-P2b  Cpo-Mir-193-P2b  Cte-Mir-193-P2  Dgr-Mir-193-P2  Dlo-Mir-193-P2  Dno-Mir-193-P2b  Dre-Mir-193-P2b1  Dre-Mir-193-P2b2  Ebu-Mir-193-P2  Eca-Mir-193-P2b  Ete-Mir-193-P2b  Gga-Mir-193-P2b  Gja-Mir-193-P2b  Gmo-Mir-193-P2b2  Hme-Mir-193-P2  Hru-Mir-193-P2  Hsa-Mir-193-P2b  Laf-Mir-193-P2b  Lch-Mir-193-P2b  Lgi-Mir-193-P2  Llo-Mir-193-P2-v1  Loc-Mir-193-P2b  Mal-Mir-193-P2b2  Mgi-Mir-193-P2  Mml-Mir-193-P2b  Mmr-Mir-193-P2b  Mmu-Mir-193-P2b  Mun-Mir-193-P2b  Neu-Mir-193-P2b  Oan-Mir-193-P2b  Ocu-Mir-193-P2b  Pab-Mir-193-P2b  Pau-Mir-193-P2  Pbv-Mir-193-P2b  Pdu-Mir-193-P2  Pfl-Mir-193-P2  Pma-Mir-193-P2  Pmi-Mir-193-P2  Pve-Mir-193-P2  Rph-Mir-193-P2  Sha-Mir-193-P2b  Sko-Mir-193-P2  Snu-Mir-193-P2  Spt-Mir-193-P2b  Spu-Mir-193-P2  Sro-Mir-193-P2  Sto-Mir-193-P2b  Tca-Mir-193-P2  Tgu-Mir-193-P2b  Tni-Mir-193-P2b2  Xbo-Mir-193-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(rn6)		 chr10: 67079810-67079871 [+] UCSC Ensembl
Clustered miRNAs
(< 50kb from Mir-193-P2b)		 Mir-193-P1b chr10: 67065915-67065970 [+] UCSC Ensembl
Mir-193-P2b chr10: 67079810-67079871 [+] UCSC Ensembl
Seed AAUGCCC
Precursor
(pre-Mir +30nt flank)		 
UGGAGAGCAUUCGAGGACAGCAAGAAAAAUGAGGGACUUUCAGGGGCAGCUGUGUUUCCUGACUCAGUCAUAAUGCCCCUAAAAAUCCUUAUUGUUCUUGCAGUGUGCAUCGGGGCAGCCAU
Get precursor sequence
Structure
        10          20        30        40        50        60 
UGGAGAGCAUUCGAGGACA--|      A        AC   C       GC    UUUCCU 
                     GCAAGAA AAUGAGGG  UUU AGGGGCA  UGUG      G
                     CGUUCUU UUAUUCCU  AAA UCCCCGU  AUAC      A
UACCGACGGGGCUACGUGUGA^      G        AA   -       A-    UGACUC 
120       110       100        90         80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Drosha cut +1 on the 5p arm.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
- +
Dr Dr Ad Bi Bi Bi Bi Br Br Br Br Ce Ce Ce Ce Co Co Co Co Du Du Du Du Fa He He He Hi Hi Il Il Je Je Ki Ki Ki Ki Ki La Li Li Li Li Li Li Lu Me Me Mu Ov Pa Pa Pa Sk Sm So So So So Sp St St St St Te Te Th Ut Wh
Star sequence

Rno-Mir-193-P2b_5p*
mirBase accessionMIMAT0017184
Sequence 
0- GAGGGACUUUCAGGGGCAGCUGUG -24
Get sequence
Proposed targets TargetScanVert: rno-miR-365-5p
miRDB: MIMAT0017184
Mature sequence

Rno-Mir-193-P2b_3p
mirBase accessionMIMAT0001549
Sequence 
40- UAAUGCCCCUAAAAAUCCUUAU -62
Get sequence
Proposed targets microrna.org: MIMAT0001549
TargetScanVert: rno-miR-365-3p
miRDB: MIMAT0001549