MirGeneDB

MirGeneDB ID

Lgi-Mir-133

Family name MIR-133 (all species)
Seed UGGUCCC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-133
Paralogues
Orthologues Aae-Mir-133  Aca-Mir-133-P1-v1  Aca-Mir-133-P1-v2  Aca-Mir-133-P2-v1  Aca-Mir-133-P2-v2  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Aca-Mir-133-P4-v1  Aca-Mir-133-P4-v2  Ami-Mir-133-P1-v1  Ami-Mir-133-P1-v2  Ami-Mir-133-P2-v1  Ami-Mir-133-P2-v2  Ami-Mir-133-P3-v1  Ami-Mir-133-P3-v2  Ami-Mir-133-P4-v1  Ami-Mir-133-P4-v2  Asu-Mir-133  Bfl-Mir-133-v1  Bfl-Mir-133-v2  Bge-Mir-133  Bta-Mir-133-P1-v1  Bta-Mir-133-P1-v2  Bta-Mir-133-P2-v1  Bta-Mir-133-P2-v2  Bta-Mir-133-P3-v1  Bta-Mir-133-P3-v2  Cbr-Mir-133  Cel-Mir-133  Cfa-Mir-133-P1-v1  Cfa-Mir-133-P1-v2  Cfa-Mir-133-P2-v1  Cfa-Mir-133-P2-v2  Cfa-Mir-133-P3-v1  Cfa-Mir-133-P3-v2  Cgi-Mir-133-v1  Cgi-Mir-133-v2  Cin-Mir-133  Cli-Mir-133-P1-v1  Cli-Mir-133-P1-v2  Cli-Mir-133-P2-v1  Cli-Mir-133-P2-v2  Cli-Mir-133-P3-v1  Cli-Mir-133-P3-v2  Cli-Mir-133-P4-v1  Cli-Mir-133-P4-v2  Cpi-Mir-133-P1-v1  Cpi-Mir-133-P1-v2  Cpi-Mir-133-P2-v1  Cpi-Mir-133-P2-v2  Cpi-Mir-133-P3-v1  Cpi-Mir-133-P3-v2  Cpi-Mir-133-P4-v1  Cpi-Mir-133-P4-v2  Cpo-Mir-133-P1-v1  Cpo-Mir-133-P1-v2  Cpo-Mir-133-P2-v1  Cpo-Mir-133-P2-v2  Cpo-Mir-133-P3-v1  Cpo-Mir-133-P3-v2  Cte-Mir-133  Dan-Mir-133  Dme-Mir-133  Dmo-Mir-133  Dno-Mir-133-P1-v1  Dno-Mir-133-P1-v2  Dno-Mir-133-P2-v1  Dno-Mir-133-P2-v2  Dno-Mir-133-P3-v1  Dno-Mir-133-P3-v2  Dpu-Mir-133  Dre-Mir-133-P1-v1  Dre-Mir-133-P1-v2  Dre-Mir-133-P2-v1  Dre-Mir-133-P2-v2  Dre-Mir-133-P3a-v1  Dre-Mir-133-P3a-v2  Dre-Mir-133-P3b-v1  Dre-Mir-133-P3b-v2  Efe-Mir-133  Ete-Mir-133-P1-v1  Ete-Mir-133-P1-v2  Ete-Mir-133-P2-v1  Ete-Mir-133-P2-v2  Ete-Mir-133-P3-v1  Ete-Mir-133-P3-v2  Gga-Mir-133-P1-v1  Gga-Mir-133-P1-v2  Gga-Mir-133-P2-v1  Gga-Mir-133-P2-v2  Gga-Mir-133-P3-v1  Gga-Mir-133-P3-v2  Gga-Mir-133-P4-v1  Gga-Mir-133-P4-v2  Hme-Mir-133  Hsa-Mir-133-P1-v1  Hsa-Mir-133-P1-v2  Hsa-Mir-133-P2-v1  Hsa-Mir-133-P2-v2  Hsa-Mir-133-P3-v1  Hsa-Mir-133-P3-v2  Isc-Mir-133  Lan-Mir-133  Mdo-Mir-133-P1-v1  Mdo-Mir-133-P1-v2  Mdo-Mir-133-P2-v1  Mdo-Mir-133-P2-v2  Mdo-Mir-133-P3-v1  Mdo-Mir-133-P3-v2  Mml-Mir-133-P1-v1  Mml-Mir-133-P1-v2  Mml-Mir-133-P2-v1  Mml-Mir-133-P2-v2  Mml-Mir-133-P3-v1  Mml-Mir-133-P3-v2  Mmu-Mir-133-P1-v1  Mmu-Mir-133-P1-v2  Mmu-Mir-133-P2-v1  Mmu-Mir-133-P2-v2  Mmu-Mir-133-P3-v1  Mmu-Mir-133-P3-v2  Oan-Mir-133-P1-v1  Oan-Mir-133-P1-v2  Oan-Mir-133-P2-v1  Oan-Mir-133-P2-v2  Oan-Mir-133-P3-v1  Oan-Mir-133-P3-v2  Oan-Mir-133-P4-v1  Oan-Mir-133-P4-v2  Ocu-Mir-133-P2-v1  Ocu-Mir-133-P2-v2  Ocu-Mir-133-P3-v1  Ocu-Mir-133-P3-v2  Pfl-Mir-133-v1  Pfl-Mir-133-v2  Pmi-Mir-133-P5a  Pmi-Mir-133-P5b  Rno-Mir-133-P1-v1  Rno-Mir-133-P1-v2  Rno-Mir-133-P2-v1  Rno-Mir-133-P2-v2  Rno-Mir-133-P3-v1  Rno-Mir-133-P3-v2  Sha-Mir-133-P1-v1  Sha-Mir-133-P1-v2  Sha-Mir-133-P2-v1  Sha-Mir-133-P2-v2  Sha-Mir-133-P3-v1  Sha-Mir-133-P3-v2  Sko-Mir-133-v1  Sko-Mir-133-v2  Spu-Mir-133  Sto-Mir-133-P1-v1  Sto-Mir-133-P1-v2  Sto-Mir-133-P2-v1  Sto-Mir-133-P2-v2  Sto-Mir-133-P4-v1  Sto-Mir-133-P4-v2  Tca-Mir-133  Tgu-Mir-133-P1-v1  Tgu-Mir-133-P1-v2  Tgu-Mir-133-P2-v1  Tgu-Mir-133-P2-v2  Tgu-Mir-133-P3-v1  Tgu-Mir-133-P3-v2  Tgu-Mir-133-P4-v1  Tgu-Mir-133-P4-v2  Xtr-Mir-133-P1-v1  Xtr-Mir-133-P1-v2  Xtr-Mir-133-P2-v1  Xtr-Mir-133-P2-v2  Xtr-Mir-133-P3-v1  Xtr-Mir-133-P3-v2  Xtr-Mir-133-P4-v1  Xtr-Mir-133-P4-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_1: 5190441-5190503 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-133)
Mir-133 LOTGIsca_1: 5190441-5190503 [-] Ensembl
Mir-1 LOTGIsca_1: 5198467-5198526 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAGACCUGAGAAUAAAAAUGCUUGUCUGUAGCUGGUUGAAAUUGGGCCAAAUUAGAAAAAGGUCAAGCAUUUGGUCCCCUUCAACCAGCUGUAGUUGGCAGAACAAUCAACAAUAUAUGAUU
Get precursor sequence
Structure
        10           20        30        40        50        60 
AAAGACCUGAGAAUAAAAA---|   UGU               AUU         UAGAAAA 
                      UGCU   CUGUAGCUGGUUGAA   GGGCCAAAU       A
                      ACGG   GAUGUCGACCAACUU   CCUGGUUUA       G
UUAGUAUAUAACAACUAACAAG^   UU-               CC-         CGAACUG 
 120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-133_5p* (predicted)

MirBase accessionMIMAT0009579
Sequence
0- AGCUGGUUGAAAUUGGGCCAAAU -23
Get sequence
Mature sequence

Lgi-Mir-133_3p

MirBase accessionMIMAT0009580
Sequence
41- UUGGUCCCCUUCAACCAGCUGU -63
Get sequence