MirGeneDB

MirGeneDB ID

Isc-Mir-133

Family name MIR-133 (all species)
Seed UGGUCCC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-133
Paralogues
Orthologues Aae-Mir-133  Aca-Mir-133-P1-v1  Aca-Mir-133-P1-v2  Aca-Mir-133-P2-v1  Aca-Mir-133-P2-v2  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Aca-Mir-133-P4-v1  Aca-Mir-133-P4-v2  Ami-Mir-133-P1-v1  Ami-Mir-133-P1-v2  Ami-Mir-133-P2-v1  Ami-Mir-133-P2-v2  Ami-Mir-133-P3-v1  Ami-Mir-133-P3-v2  Ami-Mir-133-P4-v1  Ami-Mir-133-P4-v2  Asu-Mir-133  Bfl-Mir-133-v1  Bfl-Mir-133-v2  Bge-Mir-133  Bta-Mir-133-P1-v1  Bta-Mir-133-P1-v2  Bta-Mir-133-P2-v1  Bta-Mir-133-P2-v2  Bta-Mir-133-P3-v1  Bta-Mir-133-P3-v2  Cbr-Mir-133  Cel-Mir-133  Cfa-Mir-133-P1-v1  Cfa-Mir-133-P1-v2  Cfa-Mir-133-P2-v1  Cfa-Mir-133-P2-v2  Cfa-Mir-133-P3-v1  Cfa-Mir-133-P3-v2  Cgi-Mir-133-v1  Cgi-Mir-133-v2  Cin-Mir-133  Cli-Mir-133-P1-v1  Cli-Mir-133-P1-v2  Cli-Mir-133-P2-v1  Cli-Mir-133-P2-v2  Cli-Mir-133-P3-v1  Cli-Mir-133-P3-v2  Cli-Mir-133-P4-v1  Cli-Mir-133-P4-v2  Cpi-Mir-133-P1-v1  Cpi-Mir-133-P1-v2  Cpi-Mir-133-P2-v1  Cpi-Mir-133-P2-v2  Cpi-Mir-133-P3-v1  Cpi-Mir-133-P3-v2  Cpi-Mir-133-P4-v1  Cpi-Mir-133-P4-v2  Cpo-Mir-133-P1-v1  Cpo-Mir-133-P1-v2  Cpo-Mir-133-P2-v1  Cpo-Mir-133-P2-v2  Cpo-Mir-133-P3-v1  Cpo-Mir-133-P3-v2  Cte-Mir-133  Dan-Mir-133  Dme-Mir-133  Dmo-Mir-133  Dno-Mir-133-P1-v1  Dno-Mir-133-P1-v2  Dno-Mir-133-P2-v1  Dno-Mir-133-P2-v2  Dno-Mir-133-P3-v1  Dno-Mir-133-P3-v2  Dpu-Mir-133  Dre-Mir-133-P1-v1  Dre-Mir-133-P1-v2  Dre-Mir-133-P2-v1  Dre-Mir-133-P2-v2  Dre-Mir-133-P3a-v1  Dre-Mir-133-P3a-v2  Dre-Mir-133-P3b-v1  Dre-Mir-133-P3b-v2  Efe-Mir-133  Ete-Mir-133-P1-v1  Ete-Mir-133-P1-v2  Ete-Mir-133-P2-v1  Ete-Mir-133-P2-v2  Ete-Mir-133-P3-v1  Ete-Mir-133-P3-v2  Gga-Mir-133-P1-v1  Gga-Mir-133-P1-v2  Gga-Mir-133-P2-v1  Gga-Mir-133-P2-v2  Gga-Mir-133-P3-v1  Gga-Mir-133-P3-v2  Gga-Mir-133-P4-v1  Gga-Mir-133-P4-v2  Hme-Mir-133  Hsa-Mir-133-P1-v1  Hsa-Mir-133-P1-v2  Hsa-Mir-133-P2-v1  Hsa-Mir-133-P2-v2  Hsa-Mir-133-P3-v1  Hsa-Mir-133-P3-v2  Lan-Mir-133  Lgi-Mir-133  Mdo-Mir-133-P1-v1  Mdo-Mir-133-P1-v2  Mdo-Mir-133-P2-v1  Mdo-Mir-133-P2-v2  Mdo-Mir-133-P3-v1  Mdo-Mir-133-P3-v2  Mml-Mir-133-P1-v1  Mml-Mir-133-P1-v2  Mml-Mir-133-P2-v1  Mml-Mir-133-P2-v2  Mml-Mir-133-P3-v1  Mml-Mir-133-P3-v2  Mmu-Mir-133-P1-v1  Mmu-Mir-133-P1-v2  Mmu-Mir-133-P2-v1  Mmu-Mir-133-P2-v2  Mmu-Mir-133-P3-v1  Mmu-Mir-133-P3-v2  Oan-Mir-133-P1-v1  Oan-Mir-133-P1-v2  Oan-Mir-133-P2-v1  Oan-Mir-133-P2-v2  Oan-Mir-133-P3-v1  Oan-Mir-133-P3-v2  Oan-Mir-133-P4-v1  Oan-Mir-133-P4-v2  Ocu-Mir-133-P2-v1  Ocu-Mir-133-P2-v2  Ocu-Mir-133-P3-v1  Ocu-Mir-133-P3-v2  Pfl-Mir-133-v1  Pfl-Mir-133-v2  Pmi-Mir-133-P5a  Pmi-Mir-133-P5b  Rno-Mir-133-P1-v1  Rno-Mir-133-P1-v2  Rno-Mir-133-P2-v1  Rno-Mir-133-P2-v2  Rno-Mir-133-P3-v1  Rno-Mir-133-P3-v2  Sha-Mir-133-P1-v1  Sha-Mir-133-P1-v2  Sha-Mir-133-P2-v1  Sha-Mir-133-P2-v2  Sha-Mir-133-P3-v1  Sha-Mir-133-P3-v2  Sko-Mir-133-v1  Sko-Mir-133-v2  Spu-Mir-133  Sto-Mir-133-P1-v1  Sto-Mir-133-P1-v2  Sto-Mir-133-P2-v1  Sto-Mir-133-P2-v2  Sto-Mir-133-P4-v1  Sto-Mir-133-P4-v2  Tca-Mir-133  Tgu-Mir-133-P1-v1  Tgu-Mir-133-P1-v2  Tgu-Mir-133-P2-v1  Tgu-Mir-133-P2-v2  Tgu-Mir-133-P3-v1  Tgu-Mir-133-P3-v2  Tgu-Mir-133-P4-v1  Tgu-Mir-133-P4-v2  Xtr-Mir-133-P1-v1  Xtr-Mir-133-P1-v2  Xtr-Mir-133-P2-v1  Xtr-Mir-133-P2-v2  Xtr-Mir-133-P3-v1  Xtr-Mir-133-P3-v2  Xtr-Mir-133-P4-v1  Xtr-Mir-133-P4-v2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(IscaWI)
DS613658: 228763-228842 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CACGCCGCUCCAGUGCAAAUGACCAACUUUAGCUGGCUGAAGCCGGGCCAAAUCGUCAUAAUUCCCAUGAAAAGGAAUCUCAAUACAUUUGGUCCCCUUCAACCAGCUGUGGUUGGCAUAGCUCAACAACGGAAUCAACG
Get precursor sequence
Structure
        10           20        30        40        50        60          
CACGCCGCUCCAGUGCAA---|  A      U       C     CC         CGUCAUAAUUCCCAUG 
                     AUG CCAACU UAGCUGG UGAAG  GGGCCAAAU                \
                     UAC GGUUGG GUCGACC ACUUC  CCUGGUUUA                A
GCAACUAAGGCAACAACUCGA^  -      U       A     C-         CAUAACUCUAAGGAAA 
.       130       120        110       100         90        80
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-133_5p*

MirBase accessionNone
Sequence
0- AGCUGGCUGAAGCCGGGCCAAAU -23
Get sequence
Mature sequence

Isc-Mir-133_3p

MirBase accessionMIMAT0012686
Sequence
58- UUGGUCCCCUUCAACCAGCUGU -80
Get sequence