MirGeneDB

MirGeneDB ID

Aca-Mir-133-P2-v1

Family name MIR-133 (all species)
Seed UUGGUCC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-133a-2
Paralogues Aca-Mir-133-P1-v1  Aca-Mir-133-P1-v2  Aca-Mir-133-P2-v2  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Aca-Mir-133-P4-v1  Aca-Mir-133-P4-v2 
Orthologues Aae-Mir-133  Ami-Mir-133-P2-v1  Ami-Mir-133-P2-v2  Asu-Mir-133  Bge-Mir-133  Bta-Mir-133-P2-v1  Bta-Mir-133-P2-v2  Cbr-Mir-133  Cel-Mir-133  Cfa-Mir-133-P2-v1  Cfa-Mir-133-P2-v2  Cin-Mir-133  Cli-Mir-133-P2-v1  Cli-Mir-133-P2-v2  Cpi-Mir-133-P2-v1  Cpi-Mir-133-P2-v2  Cpo-Mir-133-P2-v1  Cpo-Mir-133-P2-v2  Cte-Mir-133  Dan-Mir-133  Dme-Mir-133  Dmo-Mir-133  Dno-Mir-133-P2-v1  Dno-Mir-133-P2-v2  Dpu-Mir-133  Dre-Mir-133-P2-v1  Dre-Mir-133-P2-v2  Efe-Mir-133  Ete-Mir-133-P2-v1  Ete-Mir-133-P2-v2  Gga-Mir-133-P2-v1  Gga-Mir-133-P2-v2  Hme-Mir-133  Hsa-Mir-133-P2-v1  Hsa-Mir-133-P2-v2  Isc-Mir-133  Lan-Mir-133  Lgi-Mir-133  Mdo-Mir-133-P2-v1  Mdo-Mir-133-P2-v2  Mml-Mir-133-P2-v1  Mml-Mir-133-P2-v2  Mmu-Mir-133-P2-v1  Mmu-Mir-133-P2-v2  Oan-Mir-133-P2-v1  Oan-Mir-133-P2-v2  Ocu-Mir-133-P2-v1  Ocu-Mir-133-P2-v2  Rno-Mir-133-P2-v1  Rno-Mir-133-P2-v2  Sha-Mir-133-P2-v1  Sha-Mir-133-P2-v2  Spu-Mir-133  Sto-Mir-133-P2-v1  Sto-Mir-133-P2-v2  Tca-Mir-133  Tgu-Mir-133-P2-v1  Tgu-Mir-133-P2-v2  Xtr-Mir-133-P2-v1  Xtr-Mir-133-P2-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
4: 38863230-38863289 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-133-P2-v1)
Mir-1-P2 4: 38859458-38859518 [+] UCSC Ensembl
Mir-133-P2-v1 4: 38863230-38863289 [+] UCSC Ensembl
Mir-133-P2-v2 4: 38863230-38863289 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UACGCUUCCUUAAUGUCGAUGCUUUGCUAAAGCUGGUAAAAUGGAACCAAAUCACCUGUUAAAUGGAUUUGGUCCCCUUCAACCAGCUGUAGCUAUGUAUUGAUCACUACUGGACAAAUA
Get precursor sequence
Structure
        10          20        30        40        50         
UACGCUUCCUUAAUGUC--|    UUU    A       AA  U  A        ACCUG 
                   GAUGC   GCUA AGCUGGU  AA GG ACCAAAUC     U
                   UUAUG   CGAU UCGACCA  UU CC UGGUUUAG     U
AUAAACAGGUCAUCACUAG^    UAU    G       AC  C  C        GUAAA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-133-P2-v1_5p*

MirBase accessionNone
Sequence
0- AGCUGGUAAAAUGGAACCAAAUC -23
Get sequence
Mature sequence

Aca-Mir-133-P2-v1_3p

MirBase accessionMIMAT0021749
Sequence
37- UUUGGUCCCCUUCAACCAGCUGU -60
Get sequence