MirGeneDB

MirGeneDB ID

Lgi-Mir-12

Family name MIR-12 (all species)
Seed GAGUAUU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-12
Paralogues
Orthologues Aae-Mir-12  Bge-Mir-12  Cgi-Mir-12  Cte-Mir-12  Dan-Mir-12  Dme-Mir-12  Dmo-Mir-12  Dpu-Mir-12  Efe-Mir-12-P1  Efe-Mir-12-P2  Hme-Mir-12  Isc-Mir-12  Lan-Mir-12-P3  Lan-Mir-12-P4  Tca-Mir-12 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_22: 809271-809328 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-12)
Mir-216-P2 LOTGIsca_22: 805723-805780 [+] Ensembl
Mir-216-P1 LOTGIsca_22: 807335-807401 [+] Ensembl
Mir-12 LOTGIsca_22: 809271-809328 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAAAAUGCAUGACCAUGACAUCAUUGCCGUGAGUAUUACAUCAGGUACUGAGGAAUGUCUCGGUCAGUACCUUCUGUCAUAUUCUAAGUGAUGACGUCUUUCCCAGCACCUUGGCGU
Get precursor sequence
Structure
        10          20        30        40        50        
AUAAAAUGCAUGACCAU--|  A    UG CGU      U   UC         GGAAU 
                   GAC UCAU  C   GAGUAU ACA  AGGUACUGA     G
                   CUG AGUA  G   CUUAUA UGU  UCCAUGACU     U
UGCGGUUCCACGACCCUUU^  C    GU AAU      C   CU         GGCUC 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-12_5p

MirBase accessionMIMAT0009564
Sequence
0- UGAGUAUUACAUCAGGUACUGA -22
Get sequence
Star sequence

Lgi-Mir-12_3p* (predicted)

MirBase accessionNone
Sequence
36- AGUACCUUCUGUCAUAUUCUAA -58
Get sequence