MirGeneDB

MirGeneDB ID

Dmo-Mir-12

Family name MIR-12 (all species)
Seed GAGUAUU
Species Fruit fly (Drosophila mojavensis)
MiRBase ID dmo-mir-12
Paralogues
Orthologues Aae-Mir-12  Bge-Mir-12  Cgi-Mir-12  Cte-Mir-12  Dan-Mir-12  Dme-Mir-12  Dpu-Mir-12  Efe-Mir-12-P1  Efe-Mir-12-P2  Hme-Mir-12  Isc-Mir-12  Lan-Mir-12-P3  Lan-Mir-12-P4  Lgi-Mir-12  Tca-Mir-12 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Dmoj_caf1)
scaffold_6359: 3259793-3259856 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-12)
Mir-216-P2 scaffold_6359: 3257730-3257797 [+] Ensembl
Mir-216-P1 scaffold_6359: 3259172-3259240 [+] Ensembl
Mir-12 scaffold_6359: 3259793-3259856 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAUCAGCAUCAGCAUCAGCGUCUGUACGGUUGAGUAUUACAUCAGGUACUGGUGUGCCAAUUAACUAACAACCAGUACUUAUGUCAUACUACGCCGUGCAGUGGGCGCACUAACCGCAUGCCAC
Get precursor sequence
Structure
        10         20         30        40        50        60  
CAUCAGCAUCAGCAUCA-  GU-|        UG     U    C          GUGCCAAU 
                  GC   CUGUACGGU  AGUAU ACAU AGGUACUGGU        \
                  CG   GACGUGCCG  UCAUA UGUA UUCAUGACCA        U
CACCGUACGCCAAUCACG  GGU^        CA     C    -          ACAAUCAA 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Em Fe Ma Ma
Mature sequence

Dmo-Mir-12_5p

MirBase accessionMIMAT0008630
Sequence
0- UGAGUAUUACAUCAGGUACUGGU -23
Get sequence
Star sequence

Dmo-Mir-12_3p*

MirBase accessionNone
Sequence
42- CAGUACUUAUGUCAUACUACGC -64
Get sequence