MirGeneDB

MirGeneDB ID

Lgi-Mir-216-P1

Family name MIR-216 (all species)
Seed AAUCUCA
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-216a
Paralogues Lgi-Mir-216-P2 
Orthologues Aae-Mir-216-P1  Aca-Mir-216-P1a  Aca-Mir-216-P1b  Ami-Mir-216-P1a  Ami-Mir-216-P1b  Asu-Mir-216-P1  Bfl-Mir-216-P1  Bge-Mir-216-P1  Bta-Mir-216-P1a  Bta-Mir-216-P1b  Cbr-Mir-216-P1  Cel-Mir-216-P1  Cfa-Mir-216-P1a  Cfa-Mir-216-P1b  Cgi-Mir-216-P1  Cli-Mir-216-P1a  Cli-Mir-216-P1b  Cpi-Mir-216-P1a  Cpi-Mir-216-P1b  Cpo-Mir-216-P1a  Cpo-Mir-216-P1b  Cte-Mir-216-P1c  Cte-Mir-216-P1d  Dan-Mir-216-P1  Dme-Mir-216-P1  Dmo-Mir-216-P1  Dno-Mir-216-P1a  Dno-Mir-216-P1b  Dpu-Mir-216-P1  Dre-Mir-216-P1a  Dre-Mir-216-P1b  Efe-Mir-216-P1  Ete-Mir-216-P1a  Ete-Mir-216-P1b  Gga-Mir-216-P1a  Gga-Mir-216-P1b  Hme-Mir-216-P1  Hsa-Mir-216-P1a  Hsa-Mir-216-P1b  Isc-Mir-216-P1  Lan-Mir-216-P1e  Lan-Mir-216-P1f  Mdo-Mir-216-P1a  Mdo-Mir-216-P1b  Mml-Mir-216-P1a  Mml-Mir-216-P1b  Mmu-Mir-216-P1a  Mmu-Mir-216-P1b  Oan-Mir-216-P1a  Oan-Mir-216-P1b  Ocu-Mir-216-P1a  Ocu-Mir-216-P1b  Rno-Mir-216-P1a  Rno-Mir-216-P1b  Sha-Mir-216-P1a  Sha-Mir-216-P1b  Sto-Mir-216-P1a  Sto-Mir-216-P1b  Tca-Mir-216-P1  Tgu-Mir-216-P1a  Tgu-Mir-216-P1b  Xtr-Mir-216-P1a 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_22: 807335-807401 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-216-P1)
Mir-216-P2 LOTGIsca_22: 805723-805780 [+] Ensembl
Mir-216-P1 LOTGIsca_22: 807335-807401 [+] Ensembl
Mir-12 LOTGIsca_22: 809271-809328 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGUGAUUGACAGCUAAUCUUGAUGUUUGUGUAAUCUCAGCUGGUAAUUCUGAGUUCUAAUAAAUACUAAUUUUCUCAAGUUACUUGCCGAGAUUAUAUAAAUAUUACGUUAUACAGCAUGAGUUUAA
Get precursor sequence
Structure
        10          20        30        40        50        60   
UGUGAUUGACAGCUAAUCU--|                 A  U       C    UUCUAAUAA 
                     UGAUGUUUGUGUAAUCUC GC GGUAAUU UGAG         A
                     AUUAUAAAUAUAUUAGAG CG UCAUUGA ACUC         U
AAUUUGAGUACGACAUAUUGC^                 C  U       -    UUUUAAUCA 
     120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-216-P1_5p

MirBase accessionMIMAT0009588
Sequence
0- UAAUCUCAGCUGGUAAUUCUGAG -23
Get sequence
Star sequence

Lgi-Mir-216-P1_3p*

MirBase accessionNone
Sequence
45- CAAGUUACUUGCCGAGAUUAUA -67
Get sequence