MirGeneDB

MirGeneDB ID

Isc-Mir-67

Family name MIR-67 (all species)
Seed CUCACUC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-307
Paralogues
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Lan-Mir-67  Lgi-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS911299: 1700309-1700372 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GACCCGUCGUCGCUUGAGUCGGAGGGCCUUCCUCACUCAGUUUGGCUGUGGUGUAACGGGCGCUCGACCCAUCACAACCUCCUUGAGUGAGUGAGGCCUCGCCGAGCCACGCCACCCGUUGCUC
Get precursor sequence
Structure
        10         20         30        40        50        60 
GACCCGUCGUCGCUUGAG-    A-|     UC         UUU  C       UAACGGG 
                   UCGG  GGGCCU  CUCACUCAG   GG UGUGGUG       C
                   AGCC  UCCGGA  GAGUGAGUU   CC ACACUAC       G
CUCGUUGCCCACCGCACCG    GC^     GU         CCU  A       CCAGCUC 
  120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Mir-67_5p

MirBase accessionNone
Sequence
0- CCUCACUCAGUUUGGCUGUGGUG -23
Get sequence
Star sequence

Isc-Mir-67_3p*

MirBase accessionMIMAT0012701
Sequence
41- UCACAACCUCCUUGAGUGAGUGA -64
Get sequence