MirGeneDB

MirGeneDB ID

Lgi-Mir-67

Family name MIR-67 (all species)
Seed CACAACC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-67
Paralogues
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cgi-Mir-67-P4  Cgi-Mir-67-P5  Cgi-Mir-67-P6  Cte-Mir-67  Dan-Mir-67  Dan-Mir-67-as  Dme-Mir-67  Dme-Mir-67-as  Dmo-Mir-67  Dpu-Mir-67  Efe-Mir-67-P1  Efe-Mir-67-P2  Efe-Mir-67-P3  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Tca-Mir-67-v1  Tca-Mir-67-v2  Tca-Mir-67-v3 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_139: 406874-406933 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
UGAAAGAGUUUUAUCACGUGGUCUGUGUGUCCCUGUUCAUCGUGGUUGUGAUGUCCUCUUUGAAUCAUCACAACCUGCAUGAAUGAGGACAGGCUCGCCAUCCUCUCUACACAUCCUUGG
Get precursor sequence
Structure
        10          20        30        40         50         
UGAAAGAGUUUUAUCAC--|    CU  G     CU      C  -          UCCUC 
                   GUGGU  GU UGUCC  GUUCAU GU GGUUGUGAUG     U
                   UACCG  CG ACAGG  UAAGUA CG CCAACACUAC     U
GGUUCCUACACAUCUCUCC^    CU  G     AG      -  U          UAAGU 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-67_5p*

MirBase accessionNone
Sequence
0- CCCUGUUCAUCGUGGUUGUGAUG -23
Get sequence
Mature sequence

Lgi-Mir-67_3p

MirBase accessionMIMAT0009570
Sequence
37- UCACAACCUGCAUGAAUGAGGAC -60
Get sequence