MirGeneDB

MirGeneDB ID

Dan-Mir-33

Family name MIR-33 (all species)
Seed UGCAUUG
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-33
Paralogues
Orthologues Aae-Mir-33  Aca-Mir-33-P1  Aca-Mir-33-P2  Ami-Mir-33-P1  Ami-Mir-33-P2  Bfl-Mir-33-P3  Bfl-Mir-33-P4  Bge-Mir-33  Bta-Mir-33-P1  Bta-Mir-33-P2  Cfa-Mir-33-P1  Cfa-Mir-33-P2  Cgi-Mir-33  Cin-Mir-33  Cli-Mir-33-P1  Cli-Mir-33-P2  Cpi-Mir-33-P1  Cpi-Mir-33-P2  Cpo-Mir-33-P1  Cpo-Mir-33-P2  Cte-Mir-33  Dme-Mir-33  Dmo-Mir-33  Dno-Mir-33-P1  Dno-Mir-33-P2  Dpu-Mir-33  Dre-Mir-33-P2  Efe-Mir-33  Ete-Mir-33-P1  Ete-Mir-33-P2  Gga-Mir-33-P1  Gga-Mir-33-P2  Hme-Mir-33-P5  Hme-Mir-33-P6  Hsa-Mir-33-P1  Hsa-Mir-33-P2  Isc-Mir-33  Lan-Mir-33-P7  Lan-Mir-33-P8  Lgi-Mir-33  Mdo-Mir-33-P1  Mml-Mir-33-P1  Mml-Mir-33-P2  Mmu-Mir-33-P1  Oan-Mir-33-P1  Oan-Mir-33-P2  Ocu-Mir-33-P1  Ocu-Mir-33-P2  Pfl-Mir-33  Pmi-Mir-33  Rno-Mir-33-P1  Sha-Mir-33-P1  Sko-Mir-33  Spu-Mir-33  Sto-Mir-33-P1  Sto-Mir-33-P2  Tca-Mir-33  Tgu-Mir-33-P1  Xtr-Mir-33-P1  Xtr-Mir-33-P2 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13337: 19456811-19456871 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
UAUACACCCGCCCUCGGAGAUGUCACGCAGGUGCAUUGUAGUCGCAUUGUCUGUCCCACUUGCUCCAGGCAAUACAACUGCAGUGCAAGCUCUGUGCAUUUCACAAACAACGCCAACUUUC
Get precursor sequence
Structure
        10           20        30         40        50         
UAUACACCCGCCCUCGG---|    U    C  G-           CGC      UGUCCCA 
                    AGAUG CACG AG  UGCAUUGUAGU   AUUGUC       C
                    UUUAC GUGU UC  ACGUGACGUCA   UAACGG       U
CUUUCAACCGCAACAAACAC^    -    C  GA           ACA      ACCUCGU 
 .       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Da
Mature sequence

Dan-Mir-33_5p

MirBase accessionMIMAT0008461
Sequence
0- GUGCAUUGUAGUCGCAUUGUC -21
Get sequence
Co-mature sequence

Dan-Mir-33_3p

MirBase accessionNone
Sequence
39- CAAUACAACUGCAGUGCAAGCU -61
Get sequence