MirGeneDB

MirGeneDB ID

Aca-Mir-33-P1

Family name MIR-33 (all species)
Seed UGCAUUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-33-1
Paralogues Aca-Mir-33-P2 
Orthologues Aae-Mir-33  Ami-Mir-33-P1  Bge-Mir-33  Bta-Mir-33-P1  Cfa-Mir-33-P1  Cgi-Mir-33  Cin-Mir-33  Cli-Mir-33-P1  Cpi-Mir-33-P1  Cpo-Mir-33-P1  Cte-Mir-33  Dan-Mir-33  Dme-Mir-33  Dmo-Mir-33  Dno-Mir-33-P1  Dpu-Mir-33  Efe-Mir-33  Ete-Mir-33-P1  Gga-Mir-33-P1  Hsa-Mir-33-P1  Isc-Mir-33  Lgi-Mir-33  Mdo-Mir-33-P1  Mml-Mir-33-P1  Mmu-Mir-33-P1  Oan-Mir-33-P1  Ocu-Mir-33-P1  Pfl-Mir-33  Pmi-Mir-33  Rno-Mir-33-P1  Sha-Mir-33-P1  Sko-Mir-33  Spu-Mir-33  Sto-Mir-33-P1  Tca-Mir-33  Tgu-Mir-33-P1  Xtr-Mir-33-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
5: 26778873-26778933 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCCUUGUUACUGCUGGGUGGCAGCUGUAGUGCAUUGUAGUUGCAUUGCAUGUUCUAGCAGUAUUUGUGCAAUGUUUCCGCAGUGCAAUACAGAGGCAUACCGUAUCUCUCCACUACAGA
Get precursor sequence
Structure
        10         20         30        40        50          
ACCCCUUGUUACUGCUG-    -| AG     G        AGUU        UGUUCUAG 
                  GGUG GC  CUGUA UGCAUUGU    GCAUUGCA        \
                  CCAU CG  GACAU ACGUGACG    UGUAACGU        C
AGACAUCACCUCUCUAUG    A^ GA     A        CCUU        GUUUAUGA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-33-P1_5p

MirBase accessionMIMAT0021934
Sequence
0- GUGCAUUGUAGUUGCAUUGCA -21
Get sequence
Star sequence

Aca-Mir-33-P1_3p*

MirBase accessionMIMAT0021935
Sequence
40- CAAUGUUUCCGCAGUGCAAUA -61
Get sequence