MirGeneDB

MirGeneDB ID

Aca-Mir-30-P1a

Family name MIR-30 (all species)
Seed GUAAACA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-30a
Paralogues Aca-Mir-30-P1b  Aca-Mir-30-P1c  Aca-Mir-30-P2a  Aca-Mir-30-P2b  Aca-Mir-30-P2c 
Orthologues Ami-Mir-30-P1a  Bta-Mir-30-P1a  Cfa-Mir-30-P1a  Cli-Mir-30-P1a  Cpi-Mir-30-P1a  Cpo-Mir-30-P1a  Dno-Mir-30-P1a  Dre-Mir-30-P1a  Ete-Mir-30-P1a  Gga-Mir-30-P1a  Hsa-Mir-30-P1a  Mdo-Mir-30-P1a  Mml-Mir-30-P1a  Mmu-Mir-30-P1a  Oan-Mir-30-P1a  Ocu-Mir-30-P1a  Rno-Mir-30-P1a  Sha-Mir-30-P1a  Tgu-Mir-30-P1a  Xtr-Mir-30-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 168155618-168155681 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAUGCAUUUUGCUGUUGACGGUGAGCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCAGUAGAUGAAGCUUUCAGUCGGAUGUUUGCAGCUGCCAACUGCCACAGGCGUCAAACAUUCAG
Get precursor sequence
Structure
        10          20        30        40        50        60  
GAAUGCAUUUUGCUGUU--|A    GA   A            UC           GUGAAGC 
                   G CGGU  GCG CUGUAAACAUCC  GACUGGAAGCU       A
                   C GUCA  CGU GACGUUUGUAGG  CUGACUUUCGA       G
GACUUACAAACUGCGGACA^C    AC   C            --           AGUAGAU 
  120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-30-P1a_5p

MirBase accessionMIMAT0021920
Sequence
0- UGUAAACAUCCUCGACUGGAAGCU -24
Get sequence
Star sequence

Aca-Mir-30-P1a_3p*

MirBase accessionMIMAT0021921
Sequence
42- CUUUCAGUCGGAUGUUUGCAGC -64
Get sequence