MirGeneDB

MirGeneDB ID

Aca-Mir-30-P1b

Family name MIR-30 (all species)
Seed GUAAACA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-30e
Paralogues Aca-Mir-30-P1a  Aca-Mir-30-P1c  Aca-Mir-30-P2a  Aca-Mir-30-P2b  Aca-Mir-30-P2c 
Orthologues Ami-Mir-30-P1b  Bta-Mir-30-P1b  Cfa-Mir-30-P1b  Cli-Mir-30-P1b  Cpi-Mir-30-P1b  Cpo-Mir-30-P1b  Dno-Mir-30-P1b  Ete-Mir-30-P1b  Gga-Mir-30-P1b  Hsa-Mir-30-P1b  Mdo-Mir-30-P1b  Mml-Mir-30-P1b  Mmu-Mir-30-P1b  Oan-Mir-30-P1b  Ocu-Mir-30-P1b  Rno-Mir-30-P1b  Sha-Mir-30-P1b  Sto-Mir-30-P1b  Tgu-Mir-30-P1b  Xtr-Mir-30-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343308.1: 250303-250366 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUCCUGGAUCUAUGUAGGCAGUUGUGCUCCUGUAAACAUCCUUGACUGGAAGCUGUGCAAGGCUCAAAGGGGCUUUCAGUCGGAUGUUUACAGCGGCAGGCUGCUGCGUUCCUCCUGAAACCAC
Get precursor sequence
Structure
        10           20        30        40        50        60  
AUCCUGGAUCUAUGUAG---|     G    C            UU           GUGCAAG 
                    GCAGUU UGCU CUGUAAACAUCC  GACUGGAAGCU       G
                    CGUCGG ACGG GACAUUUGUAGG  CUGACUUUCGG       C
CACCAAAGUCCUCCUUGCGU^     -    C            --           GGAAACU 
  120       110       100         90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-30-P1b_5p

MirBase accessionMIMAT0021928
Sequence
0- UGUAAACAUCCUUGACUGGAAGCU -24
Get sequence
Co-mature sequence

Aca-Mir-30-P1b_3p

MirBase accessionMIMAT0021929
Sequence
42- CUUUCAGUCGGAUGUUUACAGC -64
Get sequence