MirGeneDB

MirGeneDB ID

Aca-Mir-30-P2b

Family name MIR-30 (all species)
Seed GUAAACA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-30-P1a  Aca-Mir-30-P1b  Aca-Mir-30-P1c  Aca-Mir-30-P2a  Aca-Mir-30-P2c 
Orthologues Ami-Mir-30-P2b  Bta-Mir-30-P2b  Cfa-Mir-30-P2b  Cli-Mir-30-P2b  Cpi-Mir-30-P2b  Cpo-Mir-30-P2b  Dno-Mir-30-P2b  Ete-Mir-30-P2b  Gga-Mir-30-P2b  Hsa-Mir-30-P2b  Mdo-Mir-30-P2b  Mml-Mir-30-P2b  Mmu-Mir-30-P2b  Oan-Mir-30-P2b  Ocu-Mir-30-P2b  Rno-Mir-30-P2b  Sha-Mir-30-P2b  Sto-Mir-30-P2b  Tgu-Mir-30-P2b  Xtr-Mir-30-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343308.1: 254254-254314 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGAUACAUCAAUUCACAUGUAGCAGCGCAUGUAAACAUCCUACACUCUCAGCUGUGAAUUUGUGGUGGCUGGGAGAAGGUUGUUUACACCUUCUGCCAUGGACUAUCACCCAAACACAAC
Get precursor sequence
Structure
        10        20          30        40        50        60 
CCGAUACAUCAAUUCACAUGUA--|   CGCA        U   ACA         GUGAAU 
                        GCAG    UGUAAACA CCU   CUCUCAGCU      \
                        CGUC    ACAUUUGU GGA   GAGGGUCGG      U
CAACACAAACCCACUAUCAGGUAC^   UUCC        U   A--         UGGUGU 
 .       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-30-P2b_5p

MirBase accessionNone
Sequence
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
Star sequence

Aca-Mir-30-P2b_3p*

MirBase accessionNone
Sequence
39- CUGGGAGAAGGUUGUUUACACC -61
Get sequence