| MirGeneDB ID | Pbv-Mir-30-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-30 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-30c-1 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-30-P1a Pbv-Mir-30-P1b Pbv-Mir-30-P1d Pbv-Mir-30-P2a Pbv-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-30-P2b Ami-Mir-30-P2b Bta-Mir-30-P2b Cfa-Mir-30-P2b Cja-Mir-30-P2b Cli-Mir-30-P2b Cmi-Mir-30-P2b Cpi-Mir-30-P2b Cpo-Mir-30-P2b Dno-Mir-30-P2b Dre-Mir-30-P2b Eca-Mir-30-P2b Ete-Mir-30-P2b Gga-Mir-30-P2b Gja-Mir-30-P2b Gmo-Mir-30-P2b Hsa-Mir-30-P2b Laf-Mir-30-P2b Lch-Mir-30-P2b Loc-Mir-30-P2b Mal-Mir-30-P2b Mdo-Mir-30-P2b Mml-Mir-30-P2b Mmr-Mir-30-P2b Mmu-Mir-30-P2b Mun-Mir-30-P2b Neu-Mir-30-P2b Oan-Mir-30-P2b Ocu-Mir-30-P2b Pab-Mir-30-P2b Rno-Mir-30-P2b Sha-Mir-30-P2b Spt-Mir-30-P2b Sto-Mir-30-P2b Tgu-Mir-30-P2b Tni-Mir-30-P2b Xla-Mir-30-P2b1 Xla-Mir-30-P2b2 Xtr-Mir-30-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE957005.1: 55738-55801 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-30-P2b) |
Mir-30-P1b
KE957005.1: 35883-35946 [+]
Mir-30-P2b KE957005.1: 55738-55801 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUAAACA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
UGAUCCGGAAUAAAUCCAAGUGACAGAGGGUGUAAACAUCCUACACUCUCAGCUGUGUGGAAAAGAAGAAAGCUGGGAGAAGGCUGUUUACUCUCUCUGCAUUGGAAAACAGCUGAAGGUGGGAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 UGAUCCGGAAUAAAUCCA---| A U U ACA GUGUGGA AGUG CAGAGGG GUAAACA CCU CUCUCAGCU A UUAC GUCUCUC CAUUUGU GGA GAGGGUCGA A AGGGUGGAAGUCGACAAAAGG^ - U C A-- AAGAAGA 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-30-P2b_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038873 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-30-P2b_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038874 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
42- CUGGGAGAAGGCUGUUUACUCU -64
Get sequence
|
