| MirGeneDB ID | Ete-Mir-30-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-30 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Lesser hedgehog tenrec (Echinops telfairi) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Ete-Mir-30-P1a Ete-Mir-30-P1b Ete-Mir-30-P1d Ete-Mir-30-P2a Ete-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-30-P2b Ami-Mir-30-P2b Bta-Mir-30-P2b Cfa-Mir-30-P2b Cja-Mir-30-P2b Cli-Mir-30-P2b Cmi-Mir-30-P2b Cpi-Mir-30-P2b Cpo-Mir-30-P2b Dno-Mir-30-P2b Dre-Mir-30-P2b Eca-Mir-30-P2b Gga-Mir-30-P2b Gja-Mir-30-P2b Gmo-Mir-30-P2b Hsa-Mir-30-P2b Laf-Mir-30-P2b Lch-Mir-30-P2b Loc-Mir-30-P2b Mal-Mir-30-P2b Mdo-Mir-30-P2b Mml-Mir-30-P2b Mmr-Mir-30-P2b Mmu-Mir-30-P2b Mun-Mir-30-P2b Neu-Mir-30-P2b Oan-Mir-30-P2b Ocu-Mir-30-P2b Pab-Mir-30-P2b Pbv-Mir-30-P2b Rno-Mir-30-P2b Sha-Mir-30-P2b Spt-Mir-30-P2b Sto-Mir-30-P2b Tgu-Mir-30-P2b Tni-Mir-30-P2b Xla-Mir-30-P2b1 Xla-Mir-30-P2b2 Xtr-Mir-30-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (echTel2) |
JH980293: 89870783-89870844 [+] UCSC | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-30-P2b) |
Mir-30-P1b
JH980293: 89828234-89828296 [+]
UCSC
Mir-30-P2b JH980293: 89870783-89870844 [+] UCSC |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUAAACA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
GUGUCUUAGAGCGGACUGAGUGACAGAUACUGUAAACAUCCCACACUCUCCGCUGUGCAAAGCCAGAAAGCCGAGAGAAGGCUGUUUACUCUUUCUGCCUUGGAAAUCAGCUAAAGAGCCACGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 GUGUCUUAGAGCGGACU----| UGA UACU U CACA C GUGCAA GAG CAGA GUAAACA CC CUCUC GCU A UUC GUCU CAUUUGU GG GAGAG CGA G CACCGAGAAAUCGACUAAAGG^ C-- UUCU C AA-- C AAGACC 120 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a one nt difference between the genomic read and the actual 5p read from the small RNA library (UGUAAACAUCCCACACUCUCAGCU). | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | Unknown | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | UG at 5p(-14), CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Ete-Mir-30-P2b_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGUAAACAUCCCACACUCUCCGCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Ete-Mir-30-P2b_3p* (predicted) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | None | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
40- CCGAGAGAAGGCUGUUUACUCU -62
Get sequence
|
