MirGeneDB

MirGeneDB ID

Bta-Mir-30-P2b

Family name MIR-30 (all species)
Seed GUAAACA
Species Cow (Bos taurus)
MiRBase ID bta-mir-30c
Paralogues Bta-Mir-30-P1a  Bta-Mir-30-P1b  Bta-Mir-30-P1c  Bta-Mir-30-P2a  Bta-Mir-30-P2c 
Orthologues Aca-Mir-30-P2b  Ami-Mir-30-P2b  Cfa-Mir-30-P2b  Cli-Mir-30-P2b  Cpi-Mir-30-P2b  Cpo-Mir-30-P2b  Dno-Mir-30-P2b  Ete-Mir-30-P2b  Gga-Mir-30-P2b  Hsa-Mir-30-P2b  Mdo-Mir-30-P2b  Mml-Mir-30-P2b  Mmu-Mir-30-P2b  Oan-Mir-30-P2b  Ocu-Mir-30-P2b  Rno-Mir-30-P2b  Sha-Mir-30-P2b  Sto-Mir-30-P2b  Tgu-Mir-30-P2b  Xtr-Mir-30-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr3: 106059377-106059437 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-30-P2b)
Mir-30-P2b chr3: 106059377-106059437 [-] UCSC Ensembl
Mir-30-P1b chr3: 106062504-106062567 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCUCAGACUGUAACCAUGCCGUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGAGCUCGAGGUGGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGAAAACGUCUGCUGAAGAAG
Get precursor sequence
Structure
        10        20           30        40        50        60 
ACCCUCAGACUGUAACCAUG  ---|   UGUGU       U   ACA         GUGAGC 
                    CC   GUAG     GUAAACA CCU   CUCUCAGCU      \
                    GG   CGUC     CAUUUGU GGG   GAGGGUCGG      U
GAAGAAGUCGUCUGCAAAA-  UAC^   UUCCU       U   A--         UGGAGC 
 .       110        100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-30-P2b_5p

MirBase accessionMIMAT0003850
Sequence
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
Validated targets TargetScanVert: bta-miR-30c
Star sequence

Bta-Mir-30-P2b_3p*

MirBase accessionNone
Sequence
39- CUGGGAGAGGGUUGUUUACUCC -61
Get sequence