MirGeneDB

MirGeneDB ID

Mmu-Mir-30-P2b

Family name MIR-30 (all species)
Seed GUAAACA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-30c-1
Paralogues Mmu-Mir-30-P1a  Mmu-Mir-30-P1b  Mmu-Mir-30-P1c  Mmu-Mir-30-P2a  Mmu-Mir-30-P2c 
Orthologues Aca-Mir-30-P2b  Ami-Mir-30-P2b  Bta-Mir-30-P2b  Cfa-Mir-30-P2b  Cli-Mir-30-P2b  Cpi-Mir-30-P2b  Cpo-Mir-30-P2b  Dno-Mir-30-P2b  Ete-Mir-30-P2b  Gga-Mir-30-P2b  Hsa-Mir-30-P2b  Mdo-Mir-30-P2b  Mml-Mir-30-P2b  Oan-Mir-30-P2b  Ocu-Mir-30-P2b  Rno-Mir-30-P2b  Sha-Mir-30-P2b  Sto-Mir-30-P2b  Tgu-Mir-30-P2b  Xtr-Mir-30-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr4: 120769546-120769606 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-30-P2b)
Mir-30-P2b chr4: 120769546-120769606 [-] UCSC Ensembl
Mir-30-P1b chr4: 120772618-120772681 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCCCUGGGCUGUAACCAUGUUGUAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGAGCUCAAGGUGGCUGGGAGAGGGUUGUUUACUCCUUCUGCCAUGGAAAACGUCAGCUGAAGAAC
Get precursor sequence
Structure
        10            20        30        40        50        60 
ACCCCUGGGCUGUAACC----|  UU    UGUGU       U   ACA         GUGAGC 
                     AUG  GUAG     GUAAACA CCU   CUCUCAGCU      \
                     UAC  CGUC     CAUUUGU GGG   GAGGGUCGG      U
CAAGAAGUCGACUGCAAAAGG^  --    UUCCU       U   A--         UGGAAC 
 .       110       100          90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-30-P2b_5p

MirBase accessionMIMAT0000514
Sequence
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
Validated targets microrna.org: MIMAT0000514
TargetScanVert: mmu-miR-30c-5p
miRDB: MIMAT0000514
Star sequence

Mmu-Mir-30-P2b_3p*

MirBase accessionMIMAT0004616
Sequence
39- CUGGGAGAGGGUUGUUUACUCC -61
Get sequence
Validated targets microrna.org: MIMAT0004616
TargetScanVert: mmu-miR-30c-1-3p
miRDB: MIMAT0004616