MirGeneDB

MirGeneDB ID

Mmu-Mir-30-P1a

Family name MIR-30 (all species)
Seed GUAAACA
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-30a
Paralogues Mmu-Mir-30-P1b  Mmu-Mir-30-P1c  Mmu-Mir-30-P2a  Mmu-Mir-30-P2b  Mmu-Mir-30-P2c 
Orthologues Aca-Mir-30-P1a  Ami-Mir-30-P1a  Bta-Mir-30-P1a  Cfa-Mir-30-P1a  Cli-Mir-30-P1a  Cpi-Mir-30-P1a  Cpo-Mir-30-P1a  Dno-Mir-30-P1a  Dre-Mir-30-P1a  Ete-Mir-30-P1a  Gga-Mir-30-P1a  Hsa-Mir-30-P1a  Mdo-Mir-30-P1a  Mml-Mir-30-P1a  Oan-Mir-30-P1a  Ocu-Mir-30-P1a  Rno-Mir-30-P1a  Sha-Mir-30-P1a  Tgu-Mir-30-P1a  Xtr-Mir-30-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr1: 23272274-23272336 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGGCAUAUCAACGUUGACAGUGAGCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAAAUGGGCUUUCAGUCGGAUGUUUGCAGCUGCCUACUGCCUCCAACUUCAAGGAGUAAU
Get precursor sequence
Structure
        10          20        30        40        50        60  
GAAGGCAUAUCAACGUUGA--|    A   A            UC           GUGAAGC 
                     CAGUG GCG CUGUAAACAUCC  GACUGGAAGCU       \
                     GUCAU CGU GACGUUUGUAGG  CUGACUUUCGG       C
UAAUGAGGAACUUCAACCUCC^    C   C            --           GUAAACA 
 120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-30-P1a_5p

MirBase accessionMIMAT0000128
Sequence
0- UGUAAACAUCCUCGACUGGAAGCU -24
Get sequence
Validated targets microrna.org: MIMAT0000128
TargetScanVert: mmu-miR-30a-5p
miRDB: MIMAT0000128
Star sequence

Mmu-Mir-30-P1a_3p*

MirBase accessionMIMAT0000129
Sequence
41- CUUUCAGUCGGAUGUUUGCAGC -63
Get sequence
Validated targets microrna.org: MIMAT0000129
TargetScanVert: mmu-miR-30a-3p
miRDB: MIMAT0000129