| MirGeneDB ID | Pbv-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-30 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Burmese python (Python bivittatus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | pbv-mir-30c-2 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | Pbv-Mir-30-P1a Pbv-Mir-30-P1b Pbv-Mir-30-P1d Pbv-Mir-30-P2a Pbv-Mir-30-P2b | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-30-P2d Ami-Mir-30-P2d Bta-Mir-30-P2d Cfa-Mir-30-P2d Cja-Mir-30-P2d Cli-Mir-30-P2d Cmi-Mir-30-P2d Cpi-Mir-30-P2d Cpo-Mir-30-P2d Dno-Mir-30-P2d Dre-Mir-30-P2d Eca-Mir-30-P2d Ete-Mir-30-P2d Gga-Mir-30-P2d Gja-Mir-30-P2d Gmo-Mir-30-P2d Hsa-Mir-30-P2d Laf-Mir-30-P2d Lch-Mir-30-P2d Loc-Mir-30-P2d Mal-Mir-30-P2d Mdo-Mir-30-P2d Mml-Mir-30-P2d Mmr-Mir-30-P2d Mmu-Mir-30-P2d Mun-Mir-30-P2d Neu-Mir-30-P2d Oan-Mir-30-P2d Ocu-Mir-30-P2d Pab-Mir-30-P2d Rno-Mir-30-P2d Sha-Mir-30-P2d Spt-Mir-30-P2d Sto-Mir-30-P2d Tgu-Mir-30-P2d Tni-Mir-30-P2d Xla-Mir-30-P2d1 Xla-Mir-30-P2d2 Xtr-Mir-30-P2d | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Gnathostomata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (GCA_000186305.2_Python_molurus_bivittatus) |
KE952992.1: 287017-287077 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-30-P2d) |
Mir-30-P1d
KE952992.1: 282996-283058 [+]
Mir-30-P2d KE952992.1: 287017-287077 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GUAAACA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CCAAUUUGACCCUAGCCAUGUAGCAGUGUGUGUAAACAUCCUACACUCUCAGCUGUGACUUUGUGGUGGCUGGGAGAAGGUUGUUUACGCCUCCUGGCAUGGACUGGUCCUCUUGGAAAUUGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 60 CCAAUUUGACCCUAGCC----| AG UGU U ACA GUGACU AUGU CAG GUGUAAACA CCU CUCUCAGCU \ UACG GUC CGCAUUUGU GGA GAGGGUCGG U UUAAAGGUUCUCCUGGUCAGG^ -- CUC U A-- UGGUGU . 110 100 90 80 70 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17), UGUG in loop | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Pbv-Mir-30-P2d_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038873 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Pbv-Mir-30-P2d_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0038875 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
39- CUGGGAGAAGGUUGUUUACGCC -61
Get sequence
|
