MirGeneDB

MirGeneDB ID

Aca-Mir-30-P2a

Family name MIR-30 (all species)
Seed GUAAACA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-30c-1
Paralogues Aca-Mir-30-P1a  Aca-Mir-30-P1b  Aca-Mir-30-P1c  Aca-Mir-30-P2b  Aca-Mir-30-P2c 
Orthologues Ami-Mir-30-P2a  Bta-Mir-30-P2a  Cfa-Mir-30-P2a  Cli-Mir-30-P2a  Cpi-Mir-30-P2a  Cpo-Mir-30-P2a  Dno-Mir-30-P2a  Dre-Mir-30-P2a  Ete-Mir-30-P2a  Gga-Mir-30-P2a  Hsa-Mir-30-P2a  Mdo-Mir-30-P2a  Mml-Mir-30-P2a  Mmu-Mir-30-P2a  Oan-Mir-30-P2a  Ocu-Mir-30-P2a  Rno-Mir-30-P2a  Sha-Mir-30-P2a  Sto-Mir-30-P2a  Tgu-Mir-30-P2a  Xtr-Mir-30-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 168132518-168132581 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGAUCCUGAAGAAUUCCAAGUGACAGGUAAUGUAAACAUCCUACACUCUCAGCUGUGUAGAUAAGAAGAAAGCUGGGAGAAGGCUGUUUACUCUCUCUGCCUUGGAAAGCAGCUGAAAGAAGAA
Get precursor sequence
Structure
        10        20         30            40        50        60  
UGAUCCUGAAGAAUUCCAAGUGA -     AU----|      U   ACA         GUGUAGA 
                       C AGGUA      GUAAACA CCU   CUCUCAGCU       U
                       G UCCGU      CAUUUGU GGA   GAGGGUCGA       A
AAGAAGAAAGUCGACGAAAG--- U     CUCUCU^      C   A--         AAGAAGA 
  120       110          100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-30-P2a_5p

MirBase accessionMIMAT0021924
Sequence
0- UGUAAACAUCCUACACUCUCAGCU -24
Get sequence
Star sequence

Aca-Mir-30-P2a_3p*

MirBase accessionMIMAT0021925
Sequence
42- CUGGGAGAAGGCUGUUUACUCU -64
Get sequence