| MirGeneDB ID | Oan-Mir-144 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Family name | MIR-144 (all species) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Species | Platypus (Ornithorhynchus anatinus) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| MiRBase ID | oan-mir-144 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Paralogues | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Orthologues | Aca-Mir-144-v1 Ami-Mir-144 Bta-Mir-144-v1 Cfa-Mir-144-v1 Cja-Mir-144-v1 Cli-Mir-144-v1 Cmi-Mir-144 Cpi-Mir-144 Cpo-Mir-144-v1 Dno-Mir-144 Dre-Mir-144-v1 Ebu-Mir-144-v1 Eca-Mir-144-v1 Ete-Mir-144 Gga-Mir-144 Gja-Mir-144-v1 Gmo-Mir-144-v1 Hsa-Mir-144-v1 Laf-Mir-144 Lch-Mir-144 Loc-Mir-144-v1 Mal-Mir-144-v1 Mdo-Mir-144 Mml-Mir-144 Mmr-Mir-144 Mmu-Mir-144-v1 Mun-Mir-144-v1 Neu-Mir-144-v1 Ocu-Mir-144-v1 Pab-Mir-144-v1 Pbv-Mir-144 Pma-Mir-144 Rno-Mir-144-v1 Sha-Mir-144 Spt-Mir-144 Sto-Mir-144 Tgu-Mir-144-v1 Tni-Mir-144 Xla-Mir-144-P1-v1 Xla-Mir-144-P2-v1 Xtr-Mir-144 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (locus) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Node of Origin (family) | Vertebrata | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Genome context (mOrnAna1.p.v1_plustraces) |
NC_041744.1: 9165005-9165062 [+] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Clustered miRNAs (< 50kb from Mir-144) |
Mir-144
NC_041744.1: 9165005-9165062 [+]
Mir-451 NC_041744.1: 9165224-9165265 [+] |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Seed | GAUAUCA | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Precursor (pre-Mir +30nt flank) |
CGCCCCCAUUGUUGCCCGGGGCCCUGGCGGGGAUAUCAUCGUAUACUGUAAGUUUGCUAUGAGACACUACAGUAUAGAUGAUGUACUAGCCUGGGUGCCCCAGCCCAGCAGGAGCCCAGet precursor sequence |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Structure | 10 20 30 40 50 CGCCCCCAUUGUUGCCC--| G U G G G A UUGCU GG GCCC GGC GG AUAUCAUC UAUACUGUA GU A CC UGGG CCG UC UGUAGUAG AUAUGACAU CA U ACCCGAGGACGACCCGACC^ G U A A - - CAGAG 110 100 90 80 70 60 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Deep sequencing |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Comment | There is a second Dicer cut +1 on both arms that corresponds to the isomirs in other taxa where the 3p arm is highly expressed. | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| 3' NTU | No | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Motifs | CNNC at 3p(+17) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Tissue expression
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Mature sequence | Oan-Mir-144_5p |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0006902 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
0- GGAUAUCAUCGUAUACUGUAAGU -23
Get sequence
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Star sequence | Oan-Mir-144_3p* |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| mirBase accession | MIMAT0006903 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| Sequence |
36- CUACAGUAUAGAUGAUGUACUA -58
Get sequence
|
