MirGeneDB

MirGeneDB ID

Lgi-Mir-1175

Family name MIR-1175 (all species)
Seed GAGAUUC
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-1175
Paralogues
Orthologues Aae-Mir-1175  Asu-Mir-1175  Bge-Mir-1175  Cgi-Mir-1175  Cte-Mir-1175  Dan-Mir-1175  Dme-Mir-1175  Dmo-Mir-1175  Dpu-Mir-1175  Efe-Mir-1175-P1  Efe-Mir-1175-P2  Hme-Mir-1175  Isc-Mir-1175  Lan-Mir-1175  Tca-Mir-1175 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(Lotgi1)
LOTGIsca_236: 116361-116422 [+] Ensembl
Clustered MiRNAs
(< 10kb from Mir-1175)
Mir-750 LOTGIsca_236: 113228-113290 [+] Ensembl
Mir-1175 LOTGIsca_236: 116361-116422 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CUAAUGCUGUAUGAAUAAGGUGUUCAAUGUAGUGGAGAGAGUUUUAUCUCAUCUCUCAAACAAAACAGAUGAGAUUCAACUCCUCCAACUGCAAGUUUCACCUGUUUACGACUUGUUUACAA
Get precursor sequence
Structure
        10          20        30         40        50        60
CUAAUGCUGUAUGAAUA--     UUCAA     -|    A     UU        UCUCAA 
                   AGGUG     UGUAG UGGAG GAGUU  AUCUCAUC      A
                   UCCAC     ACGUC ACCUC CUCAA  UAGAGUAG      C
AACAUUUGUUCAGCAUUUG     UUUGA     A^    -     CU        ACAAAA 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Lgi-Mir-1175_5p*

MirBase accessionMIMAT0009602
Sequence
0- AGUGGAGAGAGUUUUAUCUCAUC -23
Get sequence
Mature sequence

Lgi-Mir-1175_3p

MirBase accessionMIMAT0009603
Sequence
39- UGAGAUUCAACUCCUCCAACUGC -62
Get sequence