MirGeneDB

MirGeneDB ID

Isc-Mir-1175

Family name MIR-1175 (all species)
Seed GAGAUUC
Species Deer tick (Ixodes scapularis)
MiRBase ID
Paralogues
Orthologues Aae-Mir-1175  Asu-Mir-1175  Bge-Mir-1175  Cgi-Mir-1175  Cte-Mir-1175  Dan-Mir-1175  Dme-Mir-1175  Dmo-Mir-1175  Dpu-Mir-1175  Efe-Mir-1175-P1  Efe-Mir-1175-P2  Hme-Mir-1175  Lan-Mir-1175  Lgi-Mir-1175  Tca-Mir-1175 
Node of Origin (locus) Protostomia
Node of Origin (family) Protostomia
Genome context
(IscaWI)
DS874548: 51774-51835 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CAACGACGGACGACCGGGUGAUUCGGAGGCAAGUGGAGGAGUGGUCUCCUCUCUUUGCCAGACAAAAGUGAGAUUCAACUCCUCCAACUUCUCGCCGAUCACCAAACCCAUCACCGCAGCCA
Get precursor sequence
Structure
        10           20        30         40           50        
CAACGACGGACGACCGG---    U    A  C   -         --      -| CUCUUUG 
                    GUGA UCGG GG AAG UGGAGGAGU  GGUCUC CU       C
                    CACU AGCC CU UUC ACCUCCUCA  UUAGAG GA       C
ACCGACGCCACUACCCAAAC    -    G  C   A         AC      U^ AAACAGA 
120       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Star sequence

Isc-Mir-1175_5p*

MirBase accessionNone
Sequence
0- AAGUGGAGGAGUGGUCUCCUC -21
Get sequence
Mature sequence

Isc-Mir-1175_3p

MirBase accessionNone
Sequence
38- UGAGAUUCAACUCCUCCAACUUCU -62
Get sequence